ID: 1104049712

View in Genome Browser
Species Human (GRCh38)
Location 12:125187020-125187042
Sequence GTTCCCCTTTGCCTAGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104049696_1104049712 30 Left 1104049696 12:125186967-125186989 CCCGGACTTGGACAGACCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049703_1104049712 4 Left 1104049703 12:125186993-125187015 CCCTGGGAACCCAGGAGCCCCCG 0: 1
1: 0
2: 1
3: 30
4: 286
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049707_1104049712 -6 Left 1104049707 12:125187003-125187025 CCAGGAGCCCCCGGCGCGTTCCC 0: 1
1: 0
2: 2
3: 27
4: 170
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049706_1104049712 -5 Left 1104049706 12:125187002-125187024 CCCAGGAGCCCCCGGCGCGTTCC 0: 1
1: 0
2: 1
3: 14
4: 96
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049704_1104049712 3 Left 1104049704 12:125186994-125187016 CCTGGGAACCCAGGAGCCCCCGG 0: 1
1: 0
2: 4
3: 56
4: 602
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049701_1104049712 14 Left 1104049701 12:125186983-125187005 CCTGGGGAGACCCTGGGAACCCA 0: 1
1: 0
2: 4
3: 41
4: 293
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1104049698_1104049712 29 Left 1104049698 12:125186968-125186990 CCGGACTTGGACAGACCTGGGGA 0: 1
1: 0
2: 1
3: 37
4: 259
Right 1104049712 12:125187020-125187042 GTTCCCCTTTGCCTAGCGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104049712 Original CRISPR GTTCCCCTTTGCCTAGCGCC TGG Intronic