ID: 1104050018

View in Genome Browser
Species Human (GRCh38)
Location 12:125188591-125188613
Sequence GGCTCTGGAAGGCCCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 226}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104049999_1104050018 23 Left 1104049999 12:125188545-125188567 CCCCCGTCCCCCGCCCTCTCCCC 0: 1
1: 0
2: 18
3: 352
4: 3010
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050011_1104050018 2 Left 1104050011 12:125188566-125188588 CCCAGCAACAGAAGAGCCTGTGC 0: 1
1: 1
2: 2
3: 16
4: 250
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104049995_1104050018 29 Left 1104049995 12:125188539-125188561 CCCCCACCCCCGTCCCCCGCCCT 0: 1
1: 1
2: 38
3: 354
4: 2877
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104049994_1104050018 30 Left 1104049994 12:125188538-125188560 CCCCCCACCCCCGTCCCCCGCCC 0: 1
1: 9
2: 74
3: 703
4: 5030
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050009_1104050018 4 Left 1104050009 12:125188564-125188586 CCCCCAGCAACAGAAGAGCCTGT 0: 1
1: 0
2: 2
3: 24
4: 183
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050001_1104050018 21 Left 1104050001 12:125188547-125188569 CCCGTCCCCCGCCCTCTCCCCCA 0: 1
1: 1
2: 22
3: 193
4: 2579
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050005_1104050018 14 Left 1104050005 12:125188554-125188576 CCCGCCCTCTCCCCCAGCAACAG 0: 1
1: 0
2: 8
3: 67
4: 696
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050008_1104050018 9 Left 1104050008 12:125188559-125188581 CCTCTCCCCCAGCAACAGAAGAG 0: 1
1: 0
2: 2
3: 40
4: 345
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050007_1104050018 10 Left 1104050007 12:125188558-125188580 CCCTCTCCCCCAGCAACAGAAGA 0: 1
1: 0
2: 6
3: 119
4: 468
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050000_1104050018 22 Left 1104050000 12:125188546-125188568 CCCCGTCCCCCGCCCTCTCCCCC 0: 1
1: 0
2: 30
3: 752
4: 3851
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050006_1104050018 13 Left 1104050006 12:125188555-125188577 CCGCCCTCTCCCCCAGCAACAGA 0: 1
1: 0
2: 5
3: 58
4: 711
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050002_1104050018 20 Left 1104050002 12:125188548-125188570 CCGTCCCCCGCCCTCTCCCCCAG 0: 1
1: 1
2: 27
3: 299
4: 3017
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050004_1104050018 15 Left 1104050004 12:125188553-125188575 CCCCGCCCTCTCCCCCAGCAACA 0: 1
1: 0
2: 4
3: 42
4: 607
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104049997_1104050018 27 Left 1104049997 12:125188541-125188563 CCCACCCCCGTCCCCCGCCCTCT 0: 1
1: 0
2: 8
3: 129
4: 1631
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050003_1104050018 16 Left 1104050003 12:125188552-125188574 CCCCCGCCCTCTCCCCCAGCAAC 0: 1
1: 0
2: 3
3: 84
4: 900
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050012_1104050018 1 Left 1104050012 12:125188567-125188589 CCAGCAACAGAAGAGCCTGTGCC 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104049998_1104050018 26 Left 1104049998 12:125188542-125188564 CCACCCCCGTCCCCCGCCCTCTC 0: 1
1: 1
2: 27
3: 454
4: 5117
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104050010_1104050018 3 Left 1104050010 12:125188565-125188587 CCCCAGCAACAGAAGAGCCTGTG 0: 1
1: 0
2: 3
3: 27
4: 313
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226
1104049996_1104050018 28 Left 1104049996 12:125188540-125188562 CCCCACCCCCGTCCCCCGCCCTC 0: 1
1: 1
2: 20
3: 344
4: 2714
Right 1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG 0: 1
1: 0
2: 3
3: 31
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104050018 Original CRISPR GGCTCTGGAAGGCCCCATGT TGG Intronic
902240833 1:15088309-15088331 GCCTCTGTAAGGCCTCATTTAGG + Intronic
902371874 1:16012682-16012704 GGCTCTGGAAGGCCATCTGCTGG - Intergenic
902655834 1:17867493-17867515 GGGTGTGGCAGGCACCATGTGGG + Intergenic
903571028 1:24305103-24305125 GGCTCTGCAGGGCTCCAGGTGGG - Intergenic
903603237 1:24556831-24556853 GATTCTGGAAGGCCCCTTGGAGG + Intronic
903998795 1:27325552-27325574 GCCTCTGGATAGCCCTATGTTGG - Intronic
904330210 1:29753829-29753851 TCCTCTGGGAGGCCCCATGGTGG + Intergenic
905257604 1:36694915-36694937 ACCTGTGGAAGGCCCCATGCTGG + Intergenic
906743331 1:48204165-48204187 AGCTCTGAGAGGCCCCAGGTGGG - Intergenic
910431469 1:87163603-87163625 TGCTCTGAAAGGCCTCATGTTGG + Intronic
912932145 1:113973427-113973449 GCCTCGGGAAGACCCAATGTAGG - Exonic
915146991 1:153801217-153801239 GGCTGTGGCAGGCTCCAGGTTGG - Intergenic
915582502 1:156823336-156823358 GGCTCAGGAAGGCACCATCTGGG - Intronic
918261991 1:182804716-182804738 GGCTCTGGAGGGGCTCCTGTTGG - Intronic
920517181 1:206593844-206593866 GGCTCTGGAAGGCCCTCTGGAGG - Intronic
920701100 1:208218715-208218737 GGCTCCGGAATGGCACATGTGGG - Intronic
922769244 1:228173264-228173286 GTCTCTGGAAGGCCCTCTGGGGG + Intronic
924097935 1:240573795-240573817 GGCTATGGAAGGTCCCAGGCTGG - Intronic
1062925769 10:1314485-1314507 GGCCGTGGAAGGGCCGATGTGGG - Intronic
1062933229 10:1366404-1366426 GCTTCTGGAAGGCTCCATGAGGG + Intronic
1063165169 10:3455226-3455248 GGCTAAGGCAGGCCTCATGTTGG + Intergenic
1063384676 10:5608680-5608702 AGCTGAGGAAGGCCCCATGGAGG + Intergenic
1064094491 10:12412990-12413012 GGTTCTGGGAGCCCCAATGTGGG + Intronic
1069642947 10:69968085-69968107 GGCTCTGGCAGGGGTCATGTTGG - Intergenic
1070512882 10:77177121-77177143 GCCTCTGGAGAGACCCATGTTGG + Intronic
1070674581 10:78403649-78403671 GCCTCTTGAAGAACCCATGTAGG - Intergenic
1074536606 10:114332458-114332480 GGCTCAGGCAGGCCCGATATCGG + Intronic
1075545353 10:123350967-123350989 GGCTCTGGAAGGCCCCTCGTGGG + Intergenic
1075700165 10:124464160-124464182 GGCTTTGTAAGGCCTCCTGTTGG + Intronic
1076401525 10:130188631-130188653 GGCTGTGGATGGGCCCATATTGG + Intergenic
1076764698 10:132626796-132626818 GACTGTGGGAGGCCCCTTGTTGG + Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1083374005 11:62205139-62205161 GGCTCTGGAAGGCCAAAGGAGGG - Intergenic
1083583167 11:63838330-63838352 GGCTCGGCAAGGCCCCAGGCAGG - Intergenic
1083926558 11:65810743-65810765 GGCACAGGAGGGCCCCATGGTGG + Intergenic
1083945905 11:65922454-65922476 GGCTCCAGGAGGCCCCATGTGGG - Intergenic
1084022156 11:66424207-66424229 GGGTCTGGAAGGGCTCATGGAGG - Exonic
1084696787 11:70760678-70760700 GGCTCGGGAAGGCCCCATGGTGG + Intronic
1088913999 11:114213070-114213092 AGCTCTGGATGGCCCCCTGTGGG - Intronic
1089184749 11:116607226-116607248 TGCTCAGCAAGGTCCCATGTGGG + Intergenic
1090208049 11:124896571-124896593 GGCTCTGGGTGGCCCCAGGGCGG + Exonic
1090568244 11:128019410-128019432 GGCTCTGCATGGCCCCTTGAAGG - Intergenic
1094361925 12:29640030-29640052 GGCCCCGGAATGCCCCATGGGGG - Intronic
1095958469 12:47819562-47819584 GGCTCTGGCAGGCTCCGGGTCGG - Intronic
1097051268 12:56224612-56224634 GGGGCTGGAAGGCCCCCTGCCGG - Exonic
1100020982 12:90069376-90069398 GGCTCTGAAAGCCCCAATATAGG - Intergenic
1101746258 12:107544100-107544122 GACTTTGGAAGGCTCCACGTTGG - Exonic
1101759818 12:107649361-107649383 GTGTCTGGAAGGACCCGTGTTGG + Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1104071852 12:125352837-125352859 GGCTCTGGCAGATCCCAAGTAGG + Intronic
1104646305 12:130500157-130500179 GGCTCTGTAAAGAACCATGTGGG + Intronic
1105351495 13:19620254-19620276 CACTTTGGAAGGCCCCAGGTAGG - Intergenic
1105704841 13:22962399-22962421 GCCTGGGGAAGGCCCCATGGAGG - Intergenic
1105797099 13:23866161-23866183 GGCTGTGGAAGGCGCCCTGAGGG - Intronic
1105857801 13:24387557-24387579 GCCTGGGGAAGGCCCCATGGAGG - Intergenic
1106764788 13:32903072-32903094 GCCTCTGGCAGGCTCCATGGTGG + Intergenic
1112378467 13:98865818-98865840 GACCCTGGGAGGCCCCATGCAGG + Intronic
1113579200 13:111416966-111416988 GGCTCAGGAAGGGGCCTTGTGGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115908950 14:38234227-38234249 GGCTCTAGAAGGCTGCAGGTAGG - Intergenic
1116493693 14:45536204-45536226 GGCTCTCCAAGGCCACATGATGG + Intergenic
1117670603 14:58102146-58102168 GGCACTGGAAGGCCTCAGGCAGG + Intronic
1118900315 14:69980671-69980693 TGCTCTGGAAGGCAGCAGGTGGG + Intronic
1119132874 14:72190847-72190869 GGTTTTGAAAGGCCTCATGTAGG - Intronic
1119377589 14:74207040-74207062 GGCTGTGGCAGGACCCATGAAGG + Intergenic
1119921986 14:78455174-78455196 GGTGATGGAAGGTCCCATGTAGG - Intronic
1122284040 14:100640300-100640322 GGCTCTAGAAGGCTCCCTGGAGG - Intergenic
1122286121 14:100653918-100653940 GGCTCTGGGAGCCCCCGTGGAGG + Intergenic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1122969524 14:105146873-105146895 GGCTCAGGAAGGCCTCAGGCAGG - Intronic
1123041176 14:105490818-105490840 GACTCCGGAAGGCGCCCTGTGGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1124165701 15:27323917-27323939 GGCCCTGGAAGAGCCCATGTGGG - Intronic
1131077035 15:89501870-89501892 GGCCAAGGAAGGCCCCATGGAGG + Intergenic
1132551872 16:556924-556946 GGCTCTGGAAGACCCCAGCTGGG - Intergenic
1132772404 16:1571255-1571277 TGCTCTCGAATGCCTCATGTTGG - Intronic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1137393601 16:48101413-48101435 GCCTTTAGAAGGCCACATGTTGG - Intronic
1137625163 16:49903113-49903135 GGGTCTGGAAGGCCCTGGGTGGG + Intergenic
1139340004 16:66262388-66262410 AGCTCTGGACTGCCCCATGAAGG + Intergenic
1139847368 16:69930320-69930342 GGCTCTGGGAGGCCCACTTTGGG + Intronic
1140191409 16:72820186-72820208 GGCTCTGGAAGCCTCAAGGTGGG + Intronic
1140245646 16:73245689-73245711 GGTTCTGGAAGGGCCCAGGTAGG - Intergenic
1141444753 16:84050696-84050718 AGAGCTGCAAGGCCCCATGTGGG + Intergenic
1141444947 16:84051720-84051742 AGAGCTGCAAGGCCCCATGTGGG + Intergenic
1141445011 16:84052061-84052083 AGAGCTGCAAGGCCCCATGTGGG + Intergenic
1141445033 16:84052173-84052195 AGAGCTGCAAGGCCCCATGTGGG + Intergenic
1142287021 16:89175630-89175652 GGCTGATGAAGGCCCCATGCTGG + Intronic
1147044703 17:37744100-37744122 GGGTCTGGAAAGCCGCATGTCGG - Intronic
1147953343 17:44119206-44119228 TGCTCTGGCAGGGCCCACGTGGG + Intronic
1148123466 17:45225234-45225256 AGGTCAGGATGGCCCCATGTTGG + Intronic
1152292068 17:79445679-79445701 GGCTTTGGAATGCCCCATCTTGG - Intronic
1152385492 17:79971835-79971857 GGCTCTGGAAGGCTTCCTCTCGG + Intronic
1152754734 17:82082492-82082514 GGCTTTTGAGGGCCCCATTTGGG + Intronic
1163124860 19:15239333-15239355 GGCCCTGGAAGGTGCCATGCTGG - Intronic
1163722497 19:18904922-18904944 GGCTCCGGTGGGCCCCAAGTGGG - Intronic
1164626264 19:29730372-29730394 GTCTGCAGAAGGCCCCATGTTGG - Intergenic
1166080787 19:40443179-40443201 TGCTCTGTAAGGACCCATGGGGG - Intronic
927485603 2:23486508-23486530 CGCTCTGGATGGGGCCATGTGGG + Intronic
927518449 2:23685610-23685632 GGCTCTGGCTGGCCACATGCCGG + Intronic
928420486 2:31134618-31134640 GCCCTTGGAAGGCACCATGTGGG - Intronic
928861596 2:35863885-35863907 GACTATGTCAGGCCCCATGTGGG - Intergenic
929115561 2:38441169-38441191 TGCTTTGGAGGGCCCCATTTTGG - Intergenic
930289137 2:49471467-49471489 GGCTCTGAAGGGCCCACTGTAGG + Intergenic
930768850 2:55112110-55112132 GGCTCTGAGAGGCCCCCTGTGGG + Intronic
933420630 2:82041748-82041770 TGCTATGGTAGGCCCCATATTGG - Intergenic
937304693 2:120864123-120864145 GGCTCTGTGAGGGCCCGTGTGGG + Intronic
937855344 2:126668367-126668389 GGCTCTGGAAGGCACCAGGCAGG - Intronic
939712152 2:145535829-145535851 GGCTCTGGAGGGGGCCATGTAGG - Intergenic
940073798 2:149718539-149718561 TGCTCTGGAAGGCTCCATTCTGG - Intergenic
940124468 2:150309167-150309189 GGATCTGGAGGTCCCCTTGTGGG + Intergenic
940211959 2:151264124-151264146 CCCTCTGGAAGGCCCATTGTTGG - Intergenic
944107725 2:196097385-196097407 GGCTCTGGAAGCCTCCAGGTGGG + Intergenic
946152531 2:217785964-217785986 TGATCAGGAAGGCCCCATGCTGG + Intergenic
946361391 2:219221098-219221120 GCCTCTGGAAGCCCCCATGCAGG + Exonic
946486219 2:220103217-220103239 GGCACTGGGAGTTCCCATGTGGG + Intergenic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1168846136 20:945900-945922 GGCTCTGGACGGAGCCCTGTTGG + Intergenic
1170431755 20:16282751-16282773 GGCTCTGCCAGTCCCCATGCTGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171845998 20:30275119-30275141 GGCTCATGAAGGCCCTATGTTGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172005385 20:31815901-31815923 GGCTCTGGCAGCCCCTAGGTGGG + Intergenic
1172123497 20:32612002-32612024 GCCTCTGGATAGCCCAATGTGGG - Intergenic
1173431055 20:42987473-42987495 AGGTCTGGCAGGCCCCATGAGGG - Intronic
1173868510 20:46328116-46328138 GGCTTGGGAAGGCCACATGATGG + Intergenic
1174570343 20:51496952-51496974 AGCCCTGGAAGGCCCCAGGCAGG + Intronic
1175050709 20:56152730-56152752 GGCTTAGGAAGGGCCAATGTGGG - Intergenic
1175298608 20:57927135-57927157 GGCCCAGGAAGGCCCCAGGGTGG - Intergenic
1176109914 20:63406502-63406524 GGCCCTGGAGGGGCCCATGTGGG - Exonic
1176118794 20:63444964-63444986 GGCTCTGTCAGGCCCCAGGAAGG + Intronic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179067489 21:38039574-38039596 GGCACTGGCAGGCCCCCTGCTGG - Intronic
1179408249 21:41142777-41142799 GGTTCTGGAAGGCCCCAGGTGGG - Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1183975256 22:41508334-41508356 TGCTCTGGAAGGGGCCATGCAGG + Intronic
1184941313 22:47767469-47767491 GCCTCTGGATGGCCACTTGTGGG + Intergenic
1185219819 22:49623720-49623742 GGTTCTGGGAGGTCCCACGTTGG + Intronic
1185279718 22:49964846-49964868 GGCTGTGGGGTGCCCCATGTTGG + Intergenic
1185349526 22:50327216-50327238 GACCCTGGAAGGCCCCAGTTCGG - Intergenic
950451263 3:13067118-13067140 TGCTCTGTAAGGCCCCAGGTGGG + Intronic
950579866 3:13855065-13855087 GGATCTGGAAGGCCAGATGTGGG + Intronic
954713144 3:52514718-52514740 GCCACTGGAAGGCCCCATGCTGG + Exonic
955005787 3:54967064-54967086 GCCTCTGAAATGCACCATGTCGG - Intronic
956699037 3:71942616-71942638 AGCTCTGGCCTGCCCCATGTGGG + Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
960840113 3:121949317-121949339 GTCTCTCGTAGGCACCATGTAGG + Intergenic
960968429 3:123121674-123121696 GGGACTGGAAGGCACCAAGTGGG + Intronic
961677927 3:128578859-128578881 GGCTCCAGATGGCCCCATGCTGG - Intergenic
963246267 3:143066447-143066469 GCATCTGGAAGGCCAGATGTAGG + Intergenic
964633035 3:158833211-158833233 GGCTCTGGCAGGGTCCATGGAGG + Intergenic
966885161 3:184373429-184373451 GGCTCTGCAGGGCCCCAAGGAGG + Exonic
967869505 3:194218391-194218413 GCCTTAGGAAGGCCACATGTAGG + Intergenic
968297184 3:197585706-197585728 GGCCTTGGGAGGGCCCATGTCGG + Intergenic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
969787975 4:9473842-9473864 GGCTCTTGGGAGCCCCATGTCGG + Intergenic
970565394 4:17327232-17327254 GACTCTGGAAGGTCCCTTGGAGG - Intergenic
971795122 4:31217256-31217278 TGCTCTGGAAGGCCCTACCTGGG + Intergenic
980997506 4:139794306-139794328 GCCCCAGGAAGGCCACATGTGGG + Intronic
982378857 4:154726114-154726136 AACTCTGGAAGGACCCCTGTGGG + Intronic
983451474 4:167917015-167917037 AGTTCTGGAAGGGACCATGTGGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985669468 5:1200221-1200243 GGCTATGGAAGGAGCCATGTGGG + Intergenic
986359219 5:6959869-6959891 GGCTCTAGAAAGCTCCAGGTTGG - Intergenic
988642043 5:33050511-33050533 TGCTCTGGAGGGCCCCAGGATGG - Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
998019953 5:138760949-138760971 AGTTCTGGAAGGCCACATGCTGG + Intronic
998160374 5:139809629-139809651 GGCCATGGAAGGCCACATCTGGG - Exonic
1004271428 6:14199558-14199580 GGGCCAGGAAGGCCCCATGGAGG + Intergenic
1005007911 6:21308641-21308663 GGCTTCTGAAGTCCCCATGTGGG + Intergenic
1006029324 6:31167843-31167865 GGCTCTGGAAGGCCCACTTCAGG - Intronic
1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG + Intronic
1006961442 6:37934584-37934606 GACTTTGGGAGGCCCCAGGTGGG + Intronic
1007241335 6:40427857-40427879 GGCTCTGATGGGCCCCATGTAGG - Intronic
1007782324 6:44261722-44261744 GGCGCTGGCAGGCCACATGAAGG + Exonic
1008215974 6:48789352-48789374 GGCTCTGGAAGGCCAACTGAGGG - Intergenic
1008485483 6:52030606-52030628 GCCTCTGGAAGGTCTCATGCTGG - Intronic
1009703385 6:67213057-67213079 GTCTCTGGAAAGCCCCAAATGGG - Intergenic
1014109261 6:117602282-117602304 GGCCCTTGACGGCGCCATGTCGG - Exonic
1016754333 6:147667021-147667043 GGCTCTAGAAGGCTTCATGAGGG - Intronic
1017063751 6:150509593-150509615 GGCTTTGGAAGCACCCATCTAGG - Intergenic
1018799232 6:167209944-167209966 TGCTCTGGAGGGTCCCTTGTCGG - Intergenic
1019188087 6:170232674-170232696 CACGCTGGAAGGCCCCATGCAGG + Intergenic
1019306014 7:336067-336089 GGCCCTGGATGTCCCCATGGTGG - Intergenic
1020281969 7:6654472-6654494 GGCACTGGACGGCCCCTTGGCGG - Exonic
1022127370 7:27371623-27371645 GGCTCTGGAAGGGCTCATCCAGG - Intergenic
1023864737 7:44233346-44233368 GCCACTGGAAGGCCCTAGGTAGG + Intronic
1024239201 7:47421025-47421047 GACCCTGGGAGGCCCCATGTGGG - Intronic
1025712948 7:63928247-63928269 TGCTCTGGAAGGACCCCTGAAGG - Intergenic
1026422899 7:70258963-70258985 GACTCTGGAGGGCCCGATGCTGG - Intronic
1034503394 7:151466623-151466645 GCTTCAGGAAGGCCCCAGGTTGG - Exonic
1035037413 7:155904160-155904182 GGCTCTGGGAGGCCCAGTGCTGG - Intergenic
1035295433 7:157864583-157864605 GCCTCTGGAAGCTGCCATGTGGG + Intronic
1035786231 8:2263459-2263481 GGATATGGAAGGCCACATGGAGG - Intergenic
1035806576 8:2458257-2458279 GGATATGGAAGGCCACATGGAGG + Intergenic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1037289765 8:17337887-17337909 AGCTCTGGAAGTTCTCATGTGGG + Intronic
1037990881 8:23320429-23320451 GGCTCTGGAACCCGCCAGGTAGG - Intronic
1041451725 8:58013074-58013096 GGCTGTGGAAGGCCCCTGATGGG + Intronic
1041896102 8:62926361-62926383 GGCTCTGCCAGCCCCCCTGTGGG + Intronic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1045266073 8:100619612-100619634 TGCCCTGCAAGGCCCCATGTGGG - Intronic
1048935822 8:139355904-139355926 GGCTATTGGGGGCCCCATGTGGG - Intergenic
1049376700 8:142292782-142292804 GGCTCTGAAAGGCCCTTGGTGGG - Intronic
1049564607 8:143331663-143331685 GGCTCTGAAGGGACCCATCTGGG - Intronic
1049588167 8:143441381-143441403 GGCTCTGGGAGTCCCCACGCTGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1055649791 9:78396049-78396071 GGCTCTGGAAGGGCCTTAGTAGG + Intergenic
1056954928 9:91074151-91074173 GGCTCCGGAAGGCCACCTCTGGG - Intergenic
1057197475 9:93123024-93123046 GGATCTGGGCGGCCCCATGTGGG - Intronic
1059299185 9:113298830-113298852 GGCTCTGGAAGGGCTGATCTGGG - Exonic
1060022757 9:120146509-120146531 GGCCCTGGATGGCCCCACGGTGG + Intergenic
1060188040 9:121575781-121575803 GGCTTTGGAAGGCCCAGGGTGGG - Intronic
1060210034 9:121704552-121704574 AGCTCTGAGAGGTCCCATGTAGG + Intronic
1060722920 9:125990257-125990279 AGCTCTGGAAGGCCACATGGAGG - Intergenic
1061180782 9:129023873-129023895 TGCTCTGGAAGGTCTCATTTTGG - Intronic
1061398401 9:130355592-130355614 GGCCCTGGAAGGCCTCCTGGAGG + Intronic
1061406224 9:130394366-130394388 GGCTCTGCAAGCCACCATGGAGG - Intronic
1061508999 9:131049078-131049100 GGCTCAGGAGGACCCCATTTGGG - Exonic
1062485619 9:136773810-136773832 GCCTCAGGAGGGACCCATGTGGG + Intergenic
1062518883 9:136949536-136949558 GGCGCTGGGAGGCCCCTTGGGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188428315 X:30075422-30075444 AGATCAGGAAGGGCCCATGTAGG - Intergenic
1189308807 X:40006143-40006165 CGCTGTGGAAGGCCCCAGGCTGG + Intergenic
1195742125 X:108075513-108075535 GTCTCTGGAAGACCACATCTGGG - Intronic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic