ID: 1104050767

View in Genome Browser
Species Human (GRCh38)
Location 12:125192163-125192185
Sequence TTCAACAACCCTAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104050762_1104050767 5 Left 1104050762 12:125192135-125192157 CCTTCGTTAGATTTTATTTCACG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG 0: 1
1: 0
2: 1
3: 10
4: 83
1104050761_1104050767 6 Left 1104050761 12:125192134-125192156 CCCTTCGTTAGATTTTATTTCAC 0: 1
1: 0
2: 2
3: 18
4: 267
Right 1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG 0: 1
1: 0
2: 1
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104050767 Original CRISPR TTCAACAACCCTAATGGGGT AGG Intronic
903484430 1:23679093-23679115 TTCAAGAACCCTCAAGGGCTGGG + Intergenic
903971755 1:27123453-27123475 CTCAACAACCCTAATGCAGTAGG + Intronic
907666174 1:56435649-56435671 TGCAGCAACCCTAATGGGTGGGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913417724 1:118630114-118630136 TGCAGCAACCCGAATGGAGTTGG - Intergenic
918427169 1:184422425-184422447 AACAACATCCCTAATGAGGTAGG + Intronic
920969979 1:210734806-210734828 TTCAAACAACCTTATGGGGTAGG - Intronic
921200516 1:212800906-212800928 TACAAAAACCGTAATAGGGTGGG + Intronic
1063143321 10:3274875-3274897 TTGATCAAGTCTAATGGGGTGGG + Intergenic
1063986360 10:11507825-11507847 CACAACAAGCCTAATGGGGTAGG + Intronic
1070312173 10:75281831-75281853 CTCAACACCCCTAAGGGGGAGGG - Intergenic
1072711206 10:97716737-97716759 CTCAGTAACCCTAATGAGGTGGG + Intronic
1073550930 10:104400496-104400518 TTCAAAAACTCTAATGGGAGGGG + Intronic
1075349091 10:121708107-121708129 GTCAACATCTCTAGTGGGGTTGG + Intergenic
1075956877 10:126531974-126531996 TTTAACTACCCTAACTGGGTTGG + Intronic
1075995813 10:126875416-126875438 TTCACAAACCCTTATGGTGTTGG - Intergenic
1084747955 11:71185177-71185199 TTCAACAACCATAACAGTGTGGG - Intronic
1087485572 11:98756133-98756155 TTCAAAAAGACTAATGGAGTCGG - Intergenic
1092819786 12:12342530-12342552 TTCTAGAACTCTAATGGGATGGG - Intronic
1095842571 12:46710172-46710194 TTTAACAACAGAAATGGGGTTGG + Intergenic
1100786544 12:98084615-98084637 TTCAACAACCCAAATGAGCCTGG - Intergenic
1100868969 12:98890296-98890318 TTCAATATCTCTTATGGGGTTGG - Intronic
1102898431 12:116617140-116617162 TACAGCAACCCTAAAGGGATGGG - Intergenic
1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105621263 13:22069067-22069089 TTCACCAAACCTAAGGGTGTGGG + Intergenic
1111643712 13:91003403-91003425 CACAACAACCCTAATGTGGTAGG - Intergenic
1114699686 14:24664395-24664417 GTCAACAACCCGAATGAGTTTGG + Intergenic
1122079479 14:99257024-99257046 CACAGCAACCCTAATGAGGTGGG + Intronic
1128319130 15:66680404-66680426 TGCAACAGCCCTTATGAGGTAGG + Intronic
1128872425 15:71171494-71171516 TTCAACAATTCTTATGGGGCAGG - Intronic
1130437648 15:83917824-83917846 TTCATTAAGCCTAATGAGGTAGG - Intronic
1133838167 16:9384864-9384886 CTAAACAACACTCATGGGGTAGG - Intergenic
1134278007 16:12793573-12793595 CTCAACAACCCTTTTGAGGTAGG - Intronic
1135538730 16:23313967-23313989 TTCAGCAACCATATGGGGGTAGG + Intronic
1137793409 16:51194461-51194483 TTCCAAAACCCTAATGTTGTGGG - Intergenic
1139166331 16:64569040-64569062 TTCACCAGCCCTAGTGGGTTCGG - Intergenic
1141036561 16:80631158-80631180 TTAAACAACCCAACTGGGCTAGG - Intronic
1143895684 17:10134635-10134657 GCCAAGAACCCTTATGGGGTAGG - Intronic
1149038586 17:52159919-52159941 TTCAATAACCCCAAAGAGGTAGG - Intronic
1151367544 17:73627116-73627138 TTCAACAACCCCCATGAGTTTGG - Intronic
1153917806 18:9761347-9761369 TTCAACAACCCTAATGAAGTAGG - Intronic
1158024605 18:52880657-52880679 TTCAACAACACTGATGGAGGTGG - Intronic
1164408366 19:27975408-27975430 TGCAACACTCCTAATGGGGAGGG - Intergenic
927757493 2:25720687-25720709 TACAACAACACTAATAGGATAGG - Intergenic
928481143 2:31685026-31685048 TTGAACCTCCCTAATGGGGTGGG + Intergenic
931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG + Intergenic
932076548 2:68669656-68669678 TCTAACTACCCTACTGGGGTAGG - Intergenic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
935125524 2:100219283-100219305 TTCAACTACCCTGATGTGGAAGG - Intergenic
941633938 2:167915086-167915108 TCCAACAGCCCTAATGAAGTGGG - Intergenic
942283045 2:174386476-174386498 TTTAAAAACCCTAATTTGGTCGG - Intronic
947087742 2:226474919-226474941 TGCAACAACCCTGAAGGGGCTGG - Intergenic
952849078 3:37713005-37713027 TTCATCAACACTAGTGGGGCAGG - Intronic
954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG + Intronic
954685075 3:52365840-52365862 TTCAACAAGCCTGCTAGGGTCGG - Intronic
955484944 3:59425851-59425873 TTGAAAAACCCTAATGGTGATGG - Intergenic
956488429 3:69745841-69745863 TCTACCAACCCTAAGGGGGTGGG - Intronic
958082283 3:88761851-88761873 TGCAACAACCTTAATGGAGCTGG + Intergenic
958779888 3:98528096-98528118 TTCAATAAGCCTAATAGGGGTGG + Intronic
960819257 3:121710540-121710562 TTCAACAAATGTATTGGGGTTGG + Intronic
960822612 3:121750136-121750158 TTCAACAATCCTAATGGCAGCGG - Intergenic
961987043 3:131145840-131145862 CACAACAATCCTAATGAGGTAGG - Intronic
966761596 3:183424096-183424118 TTCAACAACCGAAAAGGGATAGG + Intronic
972626443 4:40804141-40804163 TTCAAAATCACTAATGGGGCCGG + Intronic
972974207 4:44613626-44613648 TTCAACCACCCTAAAGTGCTGGG - Intergenic
973583601 4:52369701-52369723 TTTGACAACCCAAATGGAGTTGG - Intergenic
975294806 4:72721605-72721627 TACAACAACCCTTATGAAGTAGG - Intergenic
977820355 4:101464472-101464494 TTCAAAAAGACTAATGGAGTTGG - Intronic
991173336 5:63654754-63654776 AGCCACAACCCTATTGGGGTAGG - Intergenic
992718329 5:79533347-79533369 CATAACAACCCTAATGGGGTAGG + Intergenic
997953299 5:138259148-138259170 TTCAACCATTCTAATGGGATGGG - Intronic
1004500172 6:16202144-16202166 TTAAAAAACCCTAAGGGGGCCGG + Intergenic
1006498990 6:34445376-34445398 GTCAACAACCTGAATGGGTTTGG - Intergenic
1016165616 6:140938937-140938959 TTCAACTAACTTAATGGGGAGGG - Intergenic
1022620790 7:31982503-31982525 ATCAACAACACTAATAGGGAAGG + Intronic
1022864017 7:34398593-34398615 TTCACCACCCCTTTTGGGGTAGG - Intergenic
1033992860 7:147309105-147309127 TCCAACAATACTACTGGGGTTGG + Intronic
1034395234 7:150818624-150818646 GACAACAACACTAATGGTGTTGG + Intergenic
1040722989 8:50348867-50348889 TTCAATAACCCTGCTGGGCTGGG + Intronic
1041538274 8:58953173-58953195 TTCAACAACATCAATGTGGTTGG + Intronic
1041627577 8:60048145-60048167 CTCAAGCACCCCAATGGGGTTGG - Intergenic
1042095148 8:65207129-65207151 TGCAGCAACCCTAATGGAGTTGG - Intergenic
1045539587 8:103070898-103070920 CCCAACATCCCTAATGCGGTGGG - Exonic
1045584004 8:103510494-103510516 TTCAACAACCCAAATGAGCAAGG - Intronic
1051711988 9:19940572-19940594 TTCCACAAGCCTTTTGGGGTTGG - Intergenic
1056184403 9:84119704-84119726 TCCAACATTCCTAATGGGATAGG + Intergenic
1056529554 9:87474789-87474811 CTCAACTACCCTAATGGGGCAGG + Intergenic
1057958354 9:99430781-99430803 GTCAACAGCCCTAATGGGAAGGG - Intergenic
1060794568 9:126505097-126505119 TTCACAAACCCTAATGAAGTGGG - Exonic
1187829863 X:23370143-23370165 TTCAACAATCCTAATGAGATGGG + Intronic
1188818513 X:34744633-34744655 TTCAACAAGCCTCATGGGAAAGG - Intergenic
1191167094 X:57402486-57402508 TTTAGAAACCCTAATGGAGTTGG - Intronic
1195029155 X:100909574-100909596 CACAACAACCCTTATGAGGTAGG - Intergenic
1199713380 X:150488220-150488242 ATCAACAACCCAAATGGGCATGG - Intronic