ID: 1104052702

View in Genome Browser
Species Human (GRCh38)
Location 12:125206812-125206834
Sequence CAAGTTTCTCACATTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104052702_1104052704 2 Left 1104052702 12:125206812-125206834 CCTTCATCAATGTGAGAAACTTG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1104052704 12:125206837-125206859 TTAGAATATTAATTTCACCTGGG 0: 1
1: 0
2: 3
3: 36
4: 396
1104052702_1104052703 1 Left 1104052702 12:125206812-125206834 CCTTCATCAATGTGAGAAACTTG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1104052703 12:125206836-125206858 ATTAGAATATTAATTTCACCTGG 0: 1
1: 0
2: 7
3: 37
4: 343
1104052702_1104052706 8 Left 1104052702 12:125206812-125206834 CCTTCATCAATGTGAGAAACTTG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1104052706 12:125206843-125206865 TATTAATTTCACCTGGGGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 306
1104052702_1104052705 3 Left 1104052702 12:125206812-125206834 CCTTCATCAATGTGAGAAACTTG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1104052705 12:125206838-125206860 TAGAATATTAATTTCACCTGGGG 0: 1
1: 0
2: 2
3: 28
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104052702 Original CRISPR CAAGTTTCTCACATTGATGA AGG (reversed) Intronic
902939979 1:19793987-19794009 CAAGGTCCTTACAATGATGATGG + Intronic
904948844 1:34219610-34219632 CAACTTGATCACATTGATGGAGG + Intergenic
905552231 1:38851350-38851372 CAAGTTTCTCCCACTGTTGTGGG - Intronic
905747345 1:40429673-40429695 GAATTTTCACACACTGATGATGG - Intergenic
906330162 1:44877673-44877695 CAGGTTTCTCACACTGGAGAGGG - Intronic
906743119 1:48201835-48201857 CAAGTTTCTCACAGTGGAGAAGG - Intergenic
908450384 1:64248511-64248533 TAAGTTTCTCACATAGATTGGGG - Intronic
908650201 1:66324414-66324436 CAATTTTCTCACATTCATAATGG + Intronic
908708340 1:66986602-66986624 AAAGTTGTTCACATTGGTGAAGG - Intronic
908894636 1:68884660-68884682 AGAATTTCTCACATTGATGCAGG + Intergenic
909698937 1:78499039-78499061 CAGCTTTCTCACATTGGGGAAGG + Intronic
912637979 1:111316526-111316548 CAATTTTCTGACTTTGAGGATGG + Intronic
912957883 1:114168401-114168423 AAATTTTCTCACTGTGATGAAGG + Intergenic
913262627 1:117013537-117013559 GAAATTGCTCACATTGATGCTGG + Exonic
915742926 1:158133103-158133125 GAGTTTTCTCACCTTGATGATGG + Intergenic
916683462 1:167124531-167124553 CATATTTGTCACATTCATGAAGG + Intronic
919001752 1:191841209-191841231 CTAGGTCCTCACACTGATGAAGG + Intergenic
921003520 1:211068973-211068995 CCAGGTTCTCACAGTGAAGACGG + Intronic
921489234 1:215753922-215753944 AAAGTCTCTCAGATTTATGATGG - Intronic
921892487 1:220367125-220367147 CAAGTTTCTTACAGTGCTGGAGG + Intergenic
924426679 1:243957631-243957653 CAAGTGACTCACATCAATGAAGG + Intergenic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1064214531 10:13388528-13388550 CTAGTTTCTCACTGTCATGAGGG + Intergenic
1064789485 10:18939808-18939830 CTAGTTTGTCACTTTCATGAGGG + Intergenic
1064983557 10:21187905-21187927 CCAGTCTCTCACAATGAAGATGG - Intergenic
1068163731 10:53301443-53301465 CAATTCCCTCACATTGATGCAGG + Intergenic
1070667604 10:78356445-78356467 CAAGTGTCTAACATTTATGGAGG + Intergenic
1071403801 10:85307437-85307459 TAAGTTGTTCACATTTATGAGGG - Intergenic
1071784615 10:88884791-88884813 CAAGTTTATCTCAATGATGATGG + Intronic
1073739361 10:106388960-106388982 CAAGTTTCTGAGATTGTTAATGG - Intergenic
1073906638 10:108288247-108288269 CAAGTTTCACATAATGTTGATGG - Intergenic
1073981991 10:109164604-109164626 CAATTTTCTCACAATCATAAAGG + Intergenic
1075394996 10:122120657-122120679 CACATTGCTCACAGTGATGAAGG + Intronic
1075561930 10:123474310-123474332 CAAGCCTTTCACTTTGATGATGG + Intergenic
1078308850 11:10218720-10218742 CCAGTTTCTCACATTTAGAATGG - Intronic
1079715925 11:23744706-23744728 AAATTTGCTCACAGTGATGAAGG - Intergenic
1080273119 11:30471801-30471823 TAAGTTTCTACCATTGATGCAGG + Intronic
1081522062 11:43891645-43891667 CTTGTTTCTCACATGGATGTTGG + Intronic
1086812990 11:91334335-91334357 TAAATTTCTCCCATTCATGAAGG - Intergenic
1088180177 11:107100817-107100839 GAACTTTCTCAACTTGATGAAGG + Intergenic
1088898298 11:114094442-114094464 AAGGTTTCTCTAATTGATGAAGG + Intronic
1088960955 11:114663925-114663947 CAACTTTGGCACATTGCTGATGG + Intergenic
1090481151 11:127069763-127069785 CAAGTAGCTCACATTCCTGAAGG - Intergenic
1091629896 12:2152023-2152045 CAAGTTTCTCACACTAGTCAAGG - Intronic
1092726263 12:11488477-11488499 CAATTTTCTGACCTTGGTGACGG + Intronic
1094290775 12:28846937-28846959 CAAGTTTAGAAAATTGATGAAGG + Intergenic
1097487076 12:60216325-60216347 GGAGTCTCTCACATTGATAATGG + Intergenic
1097668753 12:62512378-62512400 CAAGTTTCTCCCATTTAGAATGG - Intronic
1097722787 12:63041561-63041583 CATGATACTCACATTGGTGAAGG + Intergenic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1099785345 12:87255319-87255341 CAAGATTCTTCCATTGATCAAGG + Intergenic
1101059132 12:100952684-100952706 CAGTTTTATCAAATTGATGATGG + Intronic
1102730474 12:115104397-115104419 CAACTTTCTTATATTCATGAAGG + Intergenic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1105984750 13:25554426-25554448 CATGATTCTCACCTTGCTGACGG - Intronic
1106107972 13:26750811-26750833 GAAGTTTGTCACAGGGATGAAGG - Intergenic
1106870326 13:34012089-34012111 CACCTTTCTCATATTGAAGAAGG - Intergenic
1108154666 13:47573156-47573178 CCAGTTTCTCCCATTGGTGCAGG + Intergenic
1108961356 13:56235991-56236013 CTATTTTCTCACAGTGCTGAAGG + Intergenic
1109374637 13:61475624-61475646 AAACTTTCTCACTTTGATAAAGG + Intergenic
1110023308 13:70503648-70503670 CAAGTGTCTCTCAAAGATGAAGG + Intergenic
1111181315 13:84669868-84669890 CAAGTTTCTCACTTTGATGCTGG + Intergenic
1112261976 13:97885390-97885412 CAAGCTTTCCACATTGAAGAGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114797747 14:25735812-25735834 CATTTTTCTAAAATTGATGATGG - Intergenic
1115897853 14:38110123-38110145 TAAATTTCTCACTTTGATCAGGG + Intergenic
1116060753 14:39921386-39921408 CAGGTTTCTCACATGGCAGAAGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1127755204 15:62085430-62085452 GAAGTTGCTCTGATTGATGATGG + Intergenic
1129223203 15:74146860-74146882 CAAATTGCCCACTTTGATGAGGG - Intergenic
1129852810 15:78804223-78804245 CAACTCTTTCACATTAATGATGG - Intronic
1131548491 15:93335785-93335807 CAGTTTTCCCAAATTGATGAGGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG + Intergenic
1138059609 16:53876439-53876461 AAAGTTTTTAACTTTGATGAAGG - Intronic
1138969484 16:62127598-62127620 ATAGTGACTCACATTGATGAGGG + Intergenic
1139259899 16:65581433-65581455 GAACTTTCTTACATTGCTGATGG - Intergenic
1143933287 17:10454186-10454208 CAGTTTTCTCACATTTAAGAGGG + Intronic
1143946120 17:10593810-10593832 CCAGTTTCACATAATGATGAAGG - Intergenic
1144733996 17:17544813-17544835 CCAATTTCACACATGGATGATGG - Intronic
1144826959 17:18110626-18110648 CTAGATTCTCACATAGATGAAGG - Intronic
1147507656 17:41035483-41035505 CAGTTTTCTCACATGGTTGATGG - Intergenic
1149687126 17:58542424-58542446 CAAGCTAATGACATTGATGATGG - Intronic
1149771336 17:59324137-59324159 CAACTCTCTAACATTGATAATGG - Intergenic
1150061672 17:62073739-62073761 GAACTTCCTCAAATTGATGAGGG - Intergenic
1150151293 17:62810592-62810614 CCAGGTTCTCACCTTGTTGAAGG + Intergenic
1153974945 18:10261032-10261054 CATGCTTCTGACATTGGTGAAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155287343 18:24303655-24303677 CAACTTTCTCAAAATGATTAAGG - Exonic
1155528839 18:26745253-26745275 CATTTTTCTCAAATTGAAGATGG - Intergenic
1155722193 18:29029676-29029698 AAAGATTATTACATTGATGAGGG + Intergenic
1158001904 18:52629328-52629350 CAAGTTTCTGACACTGCTGCTGG + Intronic
1158828174 18:61247758-61247780 CAAGCCTCTCACCTGGATGATGG + Intergenic
1159849359 18:73508662-73508684 ATACTTTCTCACATTGGTGAGGG + Intergenic
1160580103 18:79878930-79878952 CCAGTTTCTCCCATTGTTGCTGG - Intronic
1164908144 19:31984336-31984358 GAAGGGTCTCACAGTGATGAAGG - Intergenic
1164908146 19:31984354-31984376 GAAGGGTCTCACAGTGATGAAGG - Intergenic
1165608533 19:37129637-37129659 CAGCTTTCTCACATTCATTATGG - Exonic
1166532377 19:43550872-43550894 AAGGCTTCTCACTTTGATGAGGG - Intronic
1166731551 19:45061913-45061935 CAAGTTCCTCAGAGTCATGATGG + Intronic
929103013 2:38335122-38335144 TAAGTCTCTCACACTGCTGATGG + Intronic
930424765 2:51198554-51198576 AAAGTTTTTCACATTCATGGTGG + Intergenic
931142255 2:59474902-59474924 CCAGTTTCTGACATTGCTGTCGG - Intergenic
931375980 2:61708750-61708772 CAAGTCTCTTACACTGATGCTGG - Intergenic
934405333 2:93296536-93296558 AAAGTTTCTGACATTGCTAAAGG - Intergenic
934926101 2:98382766-98382788 CCAGATTCTCACATAGATCAGGG + Intronic
935830280 2:106995002-106995024 CAGGTTGCTCACAATGTTGAGGG - Intergenic
935946557 2:108291704-108291726 CAGCTTCCTCACATTTATGAGGG + Intronic
937934550 2:127232259-127232281 CAAGTTTCTCATCTTAAAGAAGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939378034 2:141396394-141396416 TCAGTTTCTCACATTGTTAATGG + Intronic
939811742 2:146841223-146841245 CAAGGTTCTCAAATTTCTGATGG + Intergenic
939908375 2:147947939-147947961 AAAGTTTCTAATATTGCTGAAGG - Intronic
943659817 2:190547285-190547307 CCATTTTCACACATTTATGAAGG - Intergenic
943721732 2:191210755-191210777 GAACTTCCTCAAATTGATGAGGG - Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
944631649 2:201632367-201632389 CAAGTTACTTACATTTCTGAGGG + Intronic
945688102 2:212997454-212997476 CGAATTTCTCACATTGAAAAAGG + Intergenic
946765976 2:223041292-223041314 AAAGTTTCTAATTTTGATGAAGG - Intergenic
947175316 2:227360832-227360854 GAAGTTTTTAACATCGATGATGG - Intergenic
1169329075 20:4702546-4702568 CATCTTCCTCACATTGAGGAAGG + Intergenic
1169974728 20:11311764-11311786 CATGGTTCTCCCATTGAGGAAGG + Intergenic
1170184548 20:13573414-13573436 CAAGTTTCTCACAGTCCTGAAGG - Intronic
1170399831 20:15969797-15969819 GAAATTTCCCACACTGATGAAGG + Intronic
1170612569 20:17926535-17926557 CAACTTTCTCACAGTGTTGTTGG + Intergenic
1173057579 20:39630709-39630731 AAAGTTTCTCTCATTGATTCTGG - Intergenic
1173972527 20:47163822-47163844 CCAGTTTCTCACCAGGATGATGG + Intronic
1174206479 20:48843812-48843834 CAAATTTTTGACCTTGATGAAGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181314221 22:21961406-21961428 CAAGTTTGTGACAGTGAAGAGGG - Intronic
1181747701 22:24967335-24967357 CAAGCTTATGACATTGAGGAGGG - Intronic
1183314007 22:37127418-37127440 GAAGTTTGTCACCTAGATGAGGG + Exonic
1184905120 22:47477571-47477593 CAAGTTTGTAATTTTGATGATGG + Intronic
949976229 3:9462805-9462827 CAAGTTTCTCACCTTTAATATGG + Intronic
951086992 3:18524079-18524101 GAACTTTCTCAACTTGATGAAGG - Intergenic
952055297 3:29436908-29436930 AAAGTTTCACTAATTGATGAGGG + Intronic
952976464 3:38700496-38700518 CATGTTTCTGGCATTGATGGTGG + Intronic
953107115 3:39893556-39893578 CAATTTTCTCACAATGAACATGG - Intronic
954898447 3:53997277-53997299 CCAATTTCTCACACTGATGTTGG + Intergenic
956473757 3:69597101-69597123 CAATTTTCACAAATTGATCAAGG - Intergenic
959043705 3:101448286-101448308 CAAGTTTCTCACTCTCTTGATGG - Intronic
959756411 3:109905259-109905281 TGAGTTTCTCACATTGAAGCAGG + Intergenic
960244596 3:115386349-115386371 CTAGTTTCTCACATTTCTTATGG - Intergenic
962745224 3:138392451-138392473 CAAGTCTCTCATAATGATTATGG + Intronic
963033172 3:140999494-140999516 TAAGTTTCTCCTAATGATGAGGG + Intergenic
963161422 3:142154272-142154294 CAACTTTTTCACAGTGAGGATGG - Intergenic
963444158 3:145381448-145381470 CAAGTGTATCATATTGCTGATGG + Intergenic
964913679 3:161813253-161813275 CAAATTTATCACATTGATGGAGG + Intergenic
965092102 3:164177756-164177778 CATGTTTTGCACATTGAAGAAGG + Intergenic
965608053 3:170516108-170516130 CAAGTTTCTTAAATTGCTGATGG - Intronic
965864367 3:173186662-173186684 TAAATTTCTCATGTTGATGAAGG - Intergenic
969367063 4:6702194-6702216 TAATTTTCTCACTTTGATGGTGG - Intergenic
970306923 4:14742869-14742891 CAAGTTTCTCAGATCCTTGAGGG + Intergenic
970685860 4:18566450-18566472 TAAGTTTCCCATATTGATTAAGG + Intergenic
973099396 4:46245127-46245149 CAAGAATCACACAGTGATGATGG + Intergenic
974009718 4:56595441-56595463 GAAGTTGCTGACATTGAGGAGGG + Intronic
974848367 4:67379019-67379041 CAAGTTTCCAGCCTTGATGAAGG - Intergenic
976065320 4:81180657-81180679 CAAGTGTCCCACATTGATTCTGG + Intronic
978014404 4:103724166-103724188 GAACTTCCTCAAATTGATGAGGG - Intergenic
978022953 4:103835900-103835922 CCAGTTTGTCACATAGTTGATGG + Intergenic
979518822 4:121642630-121642652 CAAGTCTCCAACTTTGATGATGG + Intergenic
980610991 4:135163349-135163371 AAATTTTCTCCCATTGATAAAGG + Intergenic
983288881 4:165775612-165775634 TAAATTTCTCCCATGGATGATGG + Intergenic
984730975 4:183067856-183067878 TAAGTTTCACACAATTATGAGGG + Intergenic
986277031 5:6285400-6285422 GAACTTTATGACATTGATGAAGG + Intergenic
986819550 5:11450409-11450431 AAAATGACTCACATTGATGAAGG + Intronic
987846907 5:23298746-23298768 CCAGCATATCACATTGATGAAGG - Intergenic
989005501 5:36806728-36806750 AAATTTTCTCACCTTGATAAAGG - Intergenic
989473889 5:41852110-41852132 GAAGTTTCTCACAGTTCTGAAGG - Intronic
990221650 5:53597331-53597353 TAACTTTCTCATATTGATCAAGG + Intronic
990464539 5:56059718-56059740 GAATTTTCTTACATTGCTGACGG + Intergenic
992007735 5:72495050-72495072 GAAGTTTCCCTCATTGATGTTGG + Intronic
992041457 5:72837354-72837376 CTATTTTCTCACATGGCTGAAGG + Intronic
994667748 5:102727252-102727274 TAAGTTTCTAACAATGATGTTGG + Intergenic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
1000262978 5:159606985-159607007 CAAGGTTCTAACATTGTTCATGG - Intergenic
1000511384 5:162187879-162187901 CAATTTTCTTAAATTTATGAGGG + Intergenic
1000782491 5:165499740-165499762 CAAGTTTTTCACTTTGAATATGG + Intergenic
1006388142 6:33743508-33743530 GGAGTTTCTCACATGGCTGAGGG + Intronic
1006637486 6:35470864-35470886 GTAGTTTGTCACTTTGATGATGG + Intergenic
1009933164 6:70200944-70200966 GAAGTTTGGCAGATTGATGAAGG + Intronic
1010044881 6:71430005-71430027 CAAGTTTCACACTGGGATGATGG - Intergenic
1010085614 6:71914126-71914148 CAAGTCACTCTCATAGATGAAGG - Intronic
1010876058 6:81106874-81106896 TAATTTTCTTACAATGATGAGGG + Intergenic
1011379479 6:86727043-86727065 CAAGGTTCTCACTGTGAAGAAGG + Intergenic
1013588766 6:111602817-111602839 CAAGTATCCCTCATTGCTGAGGG + Intronic
1013818674 6:114129992-114130014 CAATTTTCTTACCTAGATGAAGG - Intronic
1013990722 6:116251797-116251819 GAAGTTGCTCACATTAAGGATGG + Exonic
1014353381 6:120372715-120372737 GAAGTTTCTCACATTGTAGATGG - Intergenic
1015338702 6:132072420-132072442 CAACTTTCCCACATTGTTGATGG - Intergenic
1015668831 6:135664495-135664517 TAATTTTCACACATTGATGGTGG + Intergenic
1016208908 6:141504953-141504975 CCAGTTTCTCACATTTAGAATGG - Intergenic
1018585920 6:165358987-165359009 TAAGTTTCTTACATTTGTGAAGG - Intronic
1020158715 7:5750726-5750748 TAAGAGTCTCACATTTATGAGGG - Intronic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1021054133 7:16026204-16026226 GTAGTTGCTCACATTAATGATGG + Intergenic
1021321209 7:19214491-19214513 CAAGTTTTACACATTGAGGTAGG + Intergenic
1022040671 7:26578571-26578593 CAAGTTTCTGATGTTGATGGAGG + Intergenic
1022481823 7:30749263-30749285 CAAAGTTGTCACATTGATGAAGG + Intronic
1023283566 7:38595423-38595445 CATGTTTCTCTCATAGATAAAGG + Intronic
1023368585 7:39489723-39489745 AAAGTTTCTAACATTGTTGTTGG - Intronic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1024247795 7:47483582-47483604 CAAGTTTCTGACATTGCACAAGG - Intronic
1028184681 7:87768634-87768656 GCAGTTTGTCACATTGGTGAGGG + Intronic
1028851080 7:95538261-95538283 CAAGTTTATTTCAGTGATGAAGG + Exonic
1030025792 7:105323379-105323401 CTATTTTCTAACATTGGTGAAGG - Intronic
1031322493 7:120349096-120349118 TAAGTTTCCCATATTTATGAGGG - Intronic
1031812392 7:126387980-126388002 GAACTTTCTCAAAGTGATGAGGG + Intergenic
1032913375 7:136459514-136459536 CAAGTTTCTCTCTTGGATGTTGG + Intergenic
1035931746 8:3787275-3787297 CAATTTTCTAAAATTGATTATGG - Intronic
1036068485 8:5411947-5411969 CAATTTTCTAACATTTCTGAAGG - Intergenic
1036425162 8:8638693-8638715 CAAGTTTCTCATCTTGAAGGAGG + Intergenic
1036488742 8:9204098-9204120 CAACCCACTCACATTGATGATGG - Intergenic
1038118620 8:24586410-24586432 CAATACACTCACATTGATGAGGG - Intergenic
1038914290 8:32002911-32002933 CATGTTTCTCACTTTGGTGTAGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041434504 8:57823053-57823075 CTAGTTGCTAACATTGTTGAAGG - Intergenic
1043526714 8:81105229-81105251 CAAGAATCTCAGATTCATGAGGG - Intronic
1043738429 8:83775895-83775917 CAAGTTCCTAACCTTGATGGAGG + Intergenic
1046776635 8:118171203-118171225 CAACTTTCACACATTGCTGGTGG + Intergenic
1047066168 8:121285893-121285915 CAAGATCCTCATATTTATGATGG + Intergenic
1051328765 9:16001210-16001232 CCAGTTTCTCAAAGTGCTGATGG + Intronic
1051959744 9:22743973-22743995 CAACTTCCTCAATTTGATGAAGG + Intergenic
1052107687 9:24539428-24539450 AAAGATTTTCACATTCATGATGG - Intergenic
1053451351 9:38196716-38196738 CAATTCTCTCACTTTAATGATGG - Intergenic
1059016836 9:110527504-110527526 GAAGTTTCATACAATGATGATGG - Intronic
1061525648 9:131159394-131159416 CAAATTTCACATACTGATGAAGG - Exonic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1185869460 X:3651678-3651700 CAAGTTTCTCAAAATGCAGACGG + Intronic
1186008629 X:5104357-5104379 CAAATTTCTTATCTTGATGATGG - Intergenic
1186972016 X:14856956-14856978 CAATTTTCTAACTTTGATAATGG + Intronic
1187747322 X:22423699-22423721 AAAGTAACTCACATTTATGAAGG + Intergenic
1188107739 X:26164039-26164061 CAGGTTTCTAACATTGATTTGGG - Intergenic
1188111127 X:26197261-26197283 CAGGTTTCTAACATTGATTTGGG - Intergenic
1192610421 X:72560696-72560718 GAACTTCCTCAAATTGATGAGGG - Intronic
1193224239 X:78962966-78962988 CACTTTTCTCATATTTATGATGG - Intergenic
1195274292 X:103265615-103265637 AAAGTTTCTCAACTTGATTAAGG - Intergenic
1195290291 X:103425643-103425665 CATGATTCTGACAGTGATGAGGG + Intergenic
1196189177 X:112777203-112777225 CAGATTTCTCACCTTAATGAAGG + Exonic
1197473618 X:126892970-126892992 CCAGGTTCTCACAGTGAAGATGG + Intergenic
1198792433 X:140360213-140360235 CCAGTTTCTCCCTTTCATGAAGG + Intergenic
1201343959 Y:12962075-12962097 CAAGTTATTCACTTTGATGCTGG - Intergenic
1202164112 Y:21968751-21968773 GAACTTTTTCACACTGATGATGG - Intergenic
1202193246 Y:22266919-22266941 CAAATTTGTAACATTCATGATGG + Intergenic
1202227244 Y:22617613-22617635 GAACTTTTTCACACTGATGATGG + Intergenic
1202315878 Y:23578041-23578063 GAACTTTTTCACACTGATGATGG - Intergenic
1202554887 Y:26092033-26092055 GAACTTTTTCACACTGATGATGG + Intergenic