ID: 1104053085

View in Genome Browser
Species Human (GRCh38)
Location 12:125209393-125209415
Sequence GCAGCAGAGTGGCTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104053078_1104053085 14 Left 1104053078 12:125209356-125209378 CCTTTGTCCCAGCCTGGGACAGC 0: 1
1: 0
2: 1
3: 35
4: 279
Right 1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG 0: 1
1: 0
2: 1
3: 37
4: 290
1104053080_1104053085 6 Left 1104053080 12:125209364-125209386 CCAGCCTGGGACAGCAGACGCTA 0: 1
1: 0
2: 1
3: 13
4: 106
Right 1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG 0: 1
1: 0
2: 1
3: 37
4: 290
1104053081_1104053085 2 Left 1104053081 12:125209368-125209390 CCTGGGACAGCAGACGCTAGCAG 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG 0: 1
1: 0
2: 1
3: 37
4: 290
1104053079_1104053085 7 Left 1104053079 12:125209363-125209385 CCCAGCCTGGGACAGCAGACGCT 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG 0: 1
1: 0
2: 1
3: 37
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104053085 Original CRISPR GCAGCAGAGTGGCTGGTCAC TGG Intronic
900374170 1:2345759-2345781 CCAGCAGAGTCACTGTTCACAGG + Intronic
900462724 1:2809227-2809249 GCAGCAGAGTTGGGGGACACGGG + Intergenic
900793663 1:4694896-4694918 GCAGCTGAGTGGACGGACACTGG + Intronic
901012926 1:6211255-6211277 CCAGCAGGGTGTCTGGGCACAGG + Intronic
902239657 1:15080147-15080169 GGAGAAGGGTGGCTGGTCATGGG + Intronic
903333637 1:22610601-22610623 TCATGAGAGTGGCTGATCACGGG + Intergenic
903997204 1:27314789-27314811 GGAGCACAGTGGCTGTTCACAGG + Intergenic
904051716 1:27643816-27643838 GCAGCAGAATAGCTGGTCTCGGG + Intergenic
904865148 1:33572544-33572566 ACTGCAGAGTGTCTGGACACAGG - Exonic
904873327 1:33635379-33635401 GCAGAACAGAGGATGGTCACTGG - Intronic
905114236 1:35623630-35623652 GCAGCACAGTGGGAGGACACTGG - Intronic
905683793 1:39894154-39894176 GCCTCAGAGTTGCTGGTCATGGG + Intergenic
906193665 1:43915202-43915224 GCTGAAGAGCTGCTGGTCACTGG + Intronic
906367408 1:45222888-45222910 GGAGCACAGTGGCTGGCCATTGG + Intronic
907359025 1:53899935-53899957 GTGGCCAAGTGGCTGGTCACTGG - Intronic
907408962 1:54271582-54271604 GCCGCAGAGTGGCTGTGAACAGG - Intronic
909268836 1:73597524-73597546 GGAGCACAGTGGCTGGCCATCGG + Intergenic
911417305 1:97590817-97590839 GAAGCAGAGAGGCTAGTCAGGGG - Intronic
913292944 1:117292053-117292075 GGAGCATAGTGGCTGTTCACAGG - Intergenic
914880389 1:151541888-151541910 GCAGTACAGTGGCTCTTCACGGG + Intronic
915545946 1:156597894-156597916 GCAACAGCAAGGCTGGTCACAGG + Intronic
915595898 1:156896427-156896449 GCAGCACAGTGGAGGGTCTCAGG - Intronic
915596278 1:156898127-156898149 GCAGCACAGTGGAGGGTCTCAGG - Intronic
916766303 1:167863777-167863799 TCAACAGAGTGGCTGAACACCGG + Intronic
919603046 1:199646880-199646902 TCAGCAGGATGTCTGGTCACAGG - Intergenic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
919787292 1:201267663-201267685 GCAGCACAGTGGAGGGGCACAGG - Intergenic
920175252 1:204097135-204097157 GCAGCAGAGTGGCTGTGACCTGG + Intronic
921458134 1:215396128-215396150 GCAGTGCAGTGGCTAGTCACAGG - Intergenic
921776554 1:219107188-219107210 GAAGCATAGTGGCTGGCCACTGG + Intergenic
923287356 1:232509167-232509189 GCAGGGGAGTGGCAGGACACAGG - Intronic
924184807 1:241476833-241476855 GCATCAGAGAGGCAGGTCAGAGG - Intergenic
1063238343 10:4142192-4142214 GCAGCACAGTGCCTGGGCACAGG - Intergenic
1064270514 10:13861112-13861134 GACGCAGGGTGGCTGGCCACTGG - Intronic
1064644812 10:17450300-17450322 TCAACAGAGTGCCTGGACACCGG + Intronic
1065032809 10:21605031-21605053 GCAGTGAAGTGGCTGTTCACAGG - Intronic
1065705405 10:28467738-28467760 GCAGCAGGATGGCTGGGCCCTGG - Intergenic
1066494075 10:35924746-35924768 GGAGCAGAGGGGATGGTCCCAGG + Intergenic
1067451156 10:46382830-46382852 GCAGCAGGCTGCCTGCTCACTGG - Intronic
1067586086 10:47476921-47476943 GCAGCAGGCTGCCTGCTCACTGG + Intronic
1067765665 10:49084042-49084064 CCATCACAGTGCCTGGTCACAGG + Intronic
1067801007 10:49359765-49359787 GCAGCAGAGCAGCTGTTCTCTGG + Intergenic
1067934955 10:50602270-50602292 GCCACAGAGTGGCTGGTTATTGG - Intronic
1069226356 10:65949908-65949930 GCATCAGAGTGGGTGGAGACTGG + Intronic
1069244902 10:66191972-66191994 GCAACAGAGTGGATGGCCAGGGG - Intronic
1069253865 10:66307901-66307923 CCAGCAGAGTGGCTGCTTAATGG - Intronic
1069753691 10:70760815-70760837 GCAGCAGGGAGGCTGGTGCCGGG - Exonic
1070114139 10:73512556-73512578 GGAGGAGAGTGGCTGTTCACAGG + Intronic
1071112420 10:82175248-82175270 GCATCAGAGAGGCTGATCACAGG - Intronic
1071876583 10:89849622-89849644 GCATCAGATTGGCTGAGCACTGG - Intergenic
1072714464 10:97740867-97740889 GCAGTAGAGTAGCTGATCCCAGG - Intronic
1073369109 10:102970644-102970666 GAAGTAGAGTGGCTGTTCACAGG + Intronic
1073462952 10:103676979-103677001 GCAGCAGAGAGGCTGGGCAGTGG + Intronic
1075284715 10:121173291-121173313 GCAGCAGAGTGCTTGATCAGAGG - Intergenic
1076771948 10:132670590-132670612 GCAGCAGAGGGGCAGGGGACAGG - Intronic
1078720669 11:13880779-13880801 GCAGCAGCGTGTGTGGTCAAGGG - Intergenic
1079021769 11:16914992-16915014 ACAGCAGAGTGGCCTGTCTCAGG - Intronic
1079766887 11:24405802-24405824 GGAGCATAGTGGCTGGCCACTGG + Intergenic
1080093932 11:28382234-28382256 ACATCAGAGTGGCTGTTCAGTGG - Intergenic
1080642160 11:34164401-34164423 GCTGCAGAGTGGCATCTCACTGG + Intronic
1081579546 11:44342830-44342852 ACAGCAGAGTGGCAGGTCCCAGG - Intergenic
1082983592 11:59146176-59146198 GCAGGAGAGTGGCTTGTACCTGG - Intronic
1083222371 11:61261124-61261146 GCAGGAGAGTTGCTGGAAACCGG + Intronic
1083746339 11:64739182-64739204 ACAGCAGAGTGGGGGCTCACAGG - Intronic
1083899213 11:65635659-65635681 GTAGCCCAGCGGCTGGTCACAGG - Exonic
1085452651 11:76644710-76644732 TCAGCATAGGGGCTGGTCACAGG + Intergenic
1086117326 11:83266533-83266555 GCAGCAGACTGGCTGGGGAAGGG + Intronic
1086208266 11:84286260-84286282 GCAGCAGAGTGGAGCATCACTGG - Intronic
1086646986 11:89234677-89234699 TCAGGGGAGTGGCTGGTCAGTGG + Intronic
1087156049 11:94905041-94905063 ACAGGAGAATGGCTGGTCAGTGG + Intergenic
1087964296 11:104393288-104393310 GCAGGAGAATGGCTGGAAACTGG + Intergenic
1088592797 11:111417738-111417760 GAAGCAGAGTGGCTGTTCTCTGG - Intronic
1089200594 11:116722562-116722584 GCAGCAGAGTGGGAGCTCACTGG + Intergenic
1089771519 11:120806532-120806554 GAAGCAGAGTCCCTGGCCACAGG - Intronic
1089892125 11:121892164-121892186 GCAGCAAAGTGACTGTTCAAAGG + Intergenic
1090122691 11:124049410-124049432 GGAGCACAGTGGCTATTCACAGG + Intergenic
1090988419 11:131794243-131794265 ACAGCAGTGTGACTGCTCACAGG - Intronic
1092953240 12:13526878-13526900 GCAGCAGAGGGGAAGGCCACAGG + Intergenic
1093466156 12:19451739-19451761 GGAGTACAGTGGCTGTTCACAGG + Intronic
1094121677 12:26981451-26981473 GCAGTGTAGTGGCTGTTCACAGG - Intronic
1096408810 12:51362610-51362632 GCTGCTGTGTGCCTGGTCACTGG + Intronic
1096555357 12:52400446-52400468 GCAGCAGAGTGGCCGCCCAGTGG - Intronic
1097063644 12:56304183-56304205 GGAGTACAGTGGCTGTTCACAGG - Intronic
1097796333 12:63866234-63866256 GAAGCATAGTGGCTGGCCACTGG - Intronic
1098017815 12:66125015-66125037 GGAGTATAGTGGCTGTTCACAGG - Intronic
1101941394 12:109101765-109101787 ATAGCAGAGTTGCTGGTCAAAGG - Intronic
1102251693 12:111391691-111391713 GCAGCGCAGTGGCTATTCACAGG - Intergenic
1102508552 12:113399049-113399071 GAAGCAGAGTGTCTGATCCCAGG + Intronic
1102872453 12:116424654-116424676 GTGACAGTGTGGCTGGTCACGGG - Intergenic
1103398450 12:120625860-120625882 GCAGCAGTGGGGCTGGTCGGCGG - Intergenic
1103569922 12:121838285-121838307 GCAGCTGCGTGGGTGGTCATGGG + Intergenic
1103704022 12:122861767-122861789 CCAGCAGGGTGGCTGGTGACAGG + Exonic
1104053085 12:125209393-125209415 GCAGCAGAGTGGCTGGTCACTGG + Intronic
1104780831 12:131419133-131419155 GCAGCAGAGTGGGGTGTCAGGGG - Intergenic
1106279610 13:28253649-28253671 GGAGCACAGTGGCTGTTCATGGG + Intronic
1107049339 13:36030797-36030819 GCAGCAGAGAGGCAGGTCCCAGG + Intronic
1107710433 13:43145608-43145630 GCTGCAGAGTGGATGATCAGAGG - Intergenic
1112327249 13:98450085-98450107 GAAGCAGAGGTGCTGGTCACAGG - Intronic
1113314067 13:109159945-109159967 GCAGCAGAGAGGCTGGAGTCGGG + Intronic
1113385005 13:109840635-109840657 GCAGAAGAATGGCTGGTTTCTGG + Intergenic
1113543063 13:111123817-111123839 GCTCCAGAGCGGCTGGTAACTGG + Intronic
1113548727 13:111175479-111175501 GCAGAAGAGTGCCTGGGCAAAGG + Intronic
1113729972 13:112634373-112634395 GTGGGAGAGGGGCTGGTCACCGG - Intergenic
1114839991 14:26252150-26252172 GGAGCACAGTGGCTATTCACAGG - Intergenic
1116920556 14:50568354-50568376 GGAGTACAGTGGCTAGTCACAGG - Intronic
1118490757 14:66257251-66257273 GGAGCATAGTGGCTGGCCATCGG - Intergenic
1121755070 14:96395411-96395433 GAAGAAGAGGGGCTGGTCTCAGG + Intronic
1122095825 14:99370876-99370898 GCAGGAGAATGGCTGCTCACTGG - Intergenic
1122278831 14:100609653-100609675 GCTGCAGAGTGGGTGGACATGGG + Intergenic
1123430787 15:20214338-20214360 GGAGCACAGTGGCTCTTCACAGG - Intergenic
1125039844 15:35172729-35172751 GGAGCACAGTGGCTATTCACAGG + Intergenic
1126701099 15:51368317-51368339 CCAGCAGCGTGGCCAGTCACTGG - Intronic
1127148846 15:56053295-56053317 GGAGCACAGTGGCTATTCACAGG - Intergenic
1128115637 15:65103125-65103147 GCAGCAAAGGGGCTGGGGACAGG - Intronic
1128530213 15:68440010-68440032 GCAGCACAGTGCCTGGTCCACGG - Intergenic
1129242668 15:74260785-74260807 ACGGCAAAGGGGCTGGTCACAGG + Intronic
1129764777 15:78156431-78156453 GGAGCACAGTGGCTACTCACAGG - Intronic
1130915926 15:88304506-88304528 GCAGCTGAGTGGCTGGTGTTGGG - Intergenic
1131627277 15:94134746-94134768 TCAGGAGAGTGAATGGTCACTGG - Intergenic
1132801556 16:1757196-1757218 GCAGGAGAGTGGCTGAACCCGGG - Intronic
1132807650 16:1782483-1782505 GCAGGTGAGTGGCGGGGCACGGG - Exonic
1133183364 16:4076152-4076174 GCAGTACAGTGGCTGTTCACAGG - Intronic
1133837100 16:9377185-9377207 GCAGCAGAGTGGATGGATTCAGG - Intergenic
1135995108 16:27241699-27241721 GAAGGAGAGTGGCTGGTCTGTGG + Intronic
1137403815 16:48174874-48174896 GGAGCACAGTGGCTATTCACAGG + Intronic
1141621921 16:85240855-85240877 GGAGCAGAGAGGCTGGACGCAGG + Intergenic
1141952133 16:87346008-87346030 GAAGCAGAGTGGCTGCTGAGAGG + Intronic
1142108558 16:88319117-88319139 GCAGGACAGTGGCCGGTCATGGG - Intergenic
1142589643 17:997049-997071 GCATCACAGTGGCTAGTCTCAGG + Intergenic
1142685147 17:1573288-1573310 GCAGCAGAGTCACCGGTCAGCGG + Intronic
1142687986 17:1588813-1588835 GCAGCAGAGTCACCGGTCAGCGG + Intronic
1142817569 17:2438979-2439001 GGAGCAGAGTTTCTGGTCTCTGG - Intronic
1146453965 17:32995291-32995313 GAAGGAGAGGGGCTGGTCTCGGG + Intronic
1146593931 17:34153616-34153638 CCAGCAGGGAGGCTGGTCTCTGG - Intronic
1146904948 17:36612271-36612293 GCAGCAGGCTGGCTGGCCTCTGG + Intergenic
1147059055 17:37859456-37859478 GCAGTGAAGTGGCTGTTCACAGG + Intergenic
1147382407 17:40063371-40063393 GCAGCAGACTGGCCGGACAGAGG - Intronic
1148439688 17:47705396-47705418 TCAGCAGAGTGCCTGGCCCCGGG + Intronic
1148578684 17:48728478-48728500 GCCGCTGGGTGGCTGGTCAGAGG + Exonic
1148850759 17:50553973-50553995 GCAGCTGAGTGGCTGGACAGAGG + Intronic
1148881863 17:50734524-50734546 GGAGTACAGTGGCTGTTCACAGG + Intronic
1149757842 17:59202510-59202532 GGAGTAGAGTGGCTATTCACAGG - Exonic
1151628311 17:75291977-75291999 GGAGCACAGTGGCTATTCACAGG - Intergenic
1152063555 17:78097172-78097194 GCAGCACAGTGGCTGTTCACAGG - Intronic
1155967370 18:32048761-32048783 GGAGCAGAGCCGATGGTCACGGG + Intronic
1156154148 18:34281521-34281543 GCAGCAGACTGGGTGGACAAAGG + Intergenic
1156803408 18:41146298-41146320 TCAGCTAAGTGGCAGGTCACTGG - Intergenic
1158686456 18:59619356-59619378 GGAGCACAGTGACTGTTCACAGG + Intronic
1159392368 18:67809366-67809388 GGAGCATAATGGTTGGTCACAGG - Intergenic
1159562704 18:70012235-70012257 ACAGCACAGTGTCTGTTCACTGG + Intronic
1159562750 18:70012637-70012659 ACAGCACAGTGTCTGCTCACTGG + Intronic
1160510875 18:79452654-79452676 GCACCAGTGTAGCTGGGCACAGG + Intronic
1161617385 19:5279252-5279274 GGAGCTAAGTGGCTGGACACAGG + Intronic
1162094368 19:8301994-8302016 GCAGCACAGTAGCTGCACACAGG + Intronic
1164667899 19:30053584-30053606 TCCGCAGAGTAGGTGGTCACTGG + Intergenic
1164724403 19:30456429-30456451 GCAGTAGACTCTCTGGTCACAGG + Intronic
1165258970 19:34597123-34597145 ACAGGTGAGTGGCTGGGCACAGG - Intronic
1165273952 19:34732780-34732802 GCAGGTGAGTGGCTGAGCACAGG + Intergenic
1166083330 19:40458559-40458581 GGAGCAGAGAGCCTGGTCAGTGG + Intronic
1167042167 19:47028658-47028680 GCGGCAGAGAGGCTGGTCCCAGG + Intronic
1168264186 19:55212635-55212657 GCAGCAGAGGGCCTGGGCTCAGG + Intergenic
1168686001 19:58350113-58350135 GCAGCAGGGAGGCTGGCCCCAGG - Intronic
927211991 2:20644740-20644762 TCAGCAGATTGGCTGGTTAAAGG + Intronic
927897894 2:26796640-26796662 GCAGCAGTGGGGGTGGGCACTGG - Intronic
927946735 2:27139216-27139238 GAACCAGAGTGGCAGGACACTGG - Intronic
929071365 2:38034265-38034287 GATGCAGAGAGGCTGGGCACAGG + Intronic
929259712 2:39851926-39851948 GCAGCAGAGGGGCTGGCCCCAGG + Intergenic
932093855 2:68829628-68829650 GCAGCAGAGAGGCTGGAGCCAGG + Intergenic
935175830 2:100648009-100648031 GCAACTGAGTGGTTGGTCATGGG + Intergenic
936630926 2:114201691-114201713 GCAGAAGAATGGCTGATCCCGGG + Intergenic
936705502 2:115067767-115067789 GCAGGAGAATGGCTGATCCCGGG + Intronic
936763643 2:115817152-115817174 GCAGGAGAATGGCTGATCCCGGG + Intronic
937887312 2:126908811-126908833 GCAGCAGACTGCCTGGTCGTCGG - Intergenic
937906026 2:127053235-127053257 GCAGCAGAATGGCTGGAGGCGGG + Intronic
938037144 2:128044463-128044485 GGAGCATAGTGGCCGGTCATCGG + Intergenic
938733488 2:134164788-134164810 GGAACAGAGTGGCTATTCACAGG - Intronic
938991027 2:136630266-136630288 GGAGCACAGTGGCTATTCACAGG + Intergenic
939559972 2:143720671-143720693 GCAGCAGAAGTGCTGGCCACAGG - Intronic
941988287 2:171529632-171529654 GCAGGACAGTGGCTGGGCAGTGG + Intronic
944179875 2:196879111-196879133 GCAGTACAGTGGCTATTCACAGG + Intronic
944949105 2:204726799-204726821 GCAGCAGAGAGGCTGAAGACAGG - Intronic
944981141 2:205121483-205121505 GCAGCACAGTGGCTAATCATAGG - Intronic
945821065 2:214666213-214666235 GGAGCATAGTGGCTGGCCATTGG + Intergenic
947220914 2:227791610-227791632 GCAGGAGAATGGCTGGACCCCGG + Intergenic
947236227 2:227944040-227944062 GCAGAAGCTTGGCAGGTCACTGG - Intergenic
949044564 2:241866577-241866599 GCAACAGAATGGCTGGACAGAGG + Intergenic
1172162661 20:32879288-32879310 GCCTCAGAGTGGCTGGCCCCGGG + Intronic
1172286313 20:33742975-33742997 GCAGCACAGTGGCTATTCACAGG - Intronic
1172820045 20:37724538-37724560 GGAGGTGAGTGTCTGGTCACTGG + Intronic
1173760591 20:45556543-45556565 GGAGCATTGTGGCTGGTCATTGG + Intronic
1174102394 20:48137594-48137616 GCAGCAGAGAGGGTGGGCACAGG - Intergenic
1174559571 20:51421019-51421041 GGAGCATAGTGGCTATTCACAGG - Intronic
1175590062 20:60182326-60182348 GGAACAGAGTGGGGGGTCACTGG - Intergenic
1177361486 21:20078031-20078053 GGAGCATAGTTGCCGGTCACTGG + Intergenic
1177944235 21:27447330-27447352 TCAGCAGAGGGGCTGGTAAATGG - Intergenic
1179710393 21:43209926-43209948 TCAGCAGTGTGGCTGGTGTCAGG + Intergenic
1180200647 21:46222115-46222137 ACTGCAGAGTGGCTGCTCAGGGG - Intronic
1181572125 22:23773290-23773312 GCAGCAGAGGGAGTGGTAACAGG + Intronic
1182175312 22:28280107-28280129 GCAGCAGACTTGCTGGCCACAGG + Intronic
1182659022 22:31912032-31912054 GCAGCACAGTTGGTGGTGACTGG - Intergenic
1183439732 22:37816399-37816421 GCCGCAGCGTGGCTGGGTACGGG - Intronic
1183478766 22:38051387-38051409 CCTGCAGAGTGGCTGGTGATGGG - Intergenic
1183521643 22:38299114-38299136 GCAGCAGAGGCTCTGCTCACGGG - Intronic
1184521970 22:44999989-45000011 GCAGCAGAGTGCCTGGTGCTCGG - Intronic
1184818569 22:46891289-46891311 TCTGGAGAGTGGCTGGTCTCCGG - Exonic
1185177172 22:49334481-49334503 GCTGCAGAATGGCAGGTCCCTGG + Intergenic
1185264864 22:49895966-49895988 TGAGCAGAGGGGCTGCTCACAGG - Intergenic
949896317 3:8769404-8769426 GCCGCAGCCTGGCTGGTCGCTGG + Exonic
950463192 3:13137781-13137803 GGAGCGCAGTGGCTGTTCACAGG - Intergenic
950867507 3:16200802-16200824 TCAGCAGAATAGCTGGTGACAGG + Exonic
951400615 3:22228337-22228359 TCAGCAGGTTGGCAGGTCACTGG + Intronic
953281144 3:41558608-41558630 GCAGCAGAATTGCTGGACCCTGG + Intronic
953413511 3:42702814-42702836 GCTGCAGAGCTGCTGGCCACAGG + Exonic
953450736 3:43003565-43003587 GCAGCAGAGTGGTAGCACACTGG + Intronic
954058422 3:48048063-48048085 CCAGTACAGTGGCTGTTCACAGG - Intronic
954314994 3:49796184-49796206 TCAGCAGAGTGACAGGTCATGGG - Intronic
957462657 3:80541703-80541725 GAAGCACAGTGGCTGTTCACAGG - Intergenic
957494573 3:80975317-80975339 GGAGCAGAGTGACTGCTCAGAGG + Intergenic
960021077 3:112954481-112954503 TCAGGATGGTGGCTGGTCACTGG + Intronic
961362452 3:126376401-126376423 GCAGCAGAGGGGCAGGTTCCCGG - Intergenic
961424032 3:126830919-126830941 GCAGCAGCGCAGCTGCTCACAGG + Intronic
961808840 3:129509380-129509402 GGAGCATAGTGGCCGGCCACTGG - Intronic
962298807 3:134218572-134218594 GCAGCACTGTGACAGGTCACAGG + Intronic
962590702 3:136887205-136887227 GGAGTACAGTGGCTGTTCACAGG + Intronic
963157960 3:142119700-142119722 GGAGCACAGTGACTGTTCACAGG - Intronic
964089123 3:152852043-152852065 ACAGCAGAGTGGCAGGACAAAGG + Intergenic
964519126 3:157544148-157544170 GCAGGAGAATGGCTGGTAGCGGG - Intronic
968202860 3:196770483-196770505 GGAGCACAGTGGCTACTCACAGG - Intronic
968565718 4:1311597-1311619 GCAGCAGCCTGGCTGATCACCGG + Intronic
968575222 4:1362877-1362899 GAAGCTGTGTGGCTGTTCACAGG - Intronic
968829422 4:2925006-2925028 GCAGCTGAGTGGATGGGGACAGG + Intronic
969248548 4:5952481-5952503 GAAGCAGCGGGGCTGGTCTCTGG + Intronic
970824350 4:20253922-20253944 GCAGCACAGTGGACTGTCACGGG + Exonic
971032441 4:22654375-22654397 GCAGTAGAGAGGCTGATCTCTGG + Intergenic
971447874 4:26771625-26771647 GAAGCAGAGTGGCTGTTGCCAGG + Intergenic
974866892 4:67592170-67592192 TGAGCACAGTGGCTGTTCACAGG + Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976686754 4:87822413-87822435 GCAGCAGTGTGGTTGGTAACTGG + Intronic
977255894 4:94739678-94739700 ACAGCAAAGTGGCTGGACACAGG - Intergenic
977336107 4:95701570-95701592 GGAGGAGAGTGGTAGGTCACTGG - Intergenic
977863954 4:102001106-102001128 GCAGCAGTGTGTATGGTCACAGG + Intronic
980173019 4:129312240-129312262 GCAGCAGAGAGGCAGGTCTATGG - Intergenic
984943005 4:184950736-184950758 GGAGCAGAGTGGTGGCTCACAGG + Intergenic
985008717 4:185560550-185560572 GAGGCAGAGAGGCTGGTCACTGG - Intergenic
985519679 5:367715-367737 GCAGCAGAGGGGGTGGTGTCAGG - Intronic
989170193 5:38465988-38466010 GCAGCAGAGTGGAGGGACCCAGG + Intergenic
990232124 5:53724525-53724547 GAAGCATAGTGGCTGGCCATCGG + Intergenic
990580135 5:57160150-57160172 CCAGCAGAGAGGTGGGTCACTGG - Intergenic
990885161 5:60583110-60583132 GCAGCAGAATGACTGGTTCCAGG + Intergenic
992077071 5:73201867-73201889 GCAGCAGGGTGTCTGGGCATTGG - Intergenic
992594765 5:78334927-78334949 ACAGCAGAGGGGCTGGGCCCAGG + Intergenic
992680992 5:79152976-79152998 GGAGCACAGTGGCTATTCACAGG - Intronic
996053249 5:118955743-118955765 GGAGCATAGTGGCTATTCACTGG - Intronic
996863329 5:128089346-128089368 GAAGCGCAGTGGCTGTTCACAGG - Intronic
997013661 5:129905700-129905722 GCAGCGGAGGGGCTGGGCAGGGG - Intronic
998949296 5:147375690-147375712 ACAGAAGAGTGTCTGTTCACAGG + Intronic
1000796409 5:165670266-165670288 GCAGCAGGTAGGCTGGTCATGGG + Intergenic
1002915138 6:1522947-1522969 GGAGCACAGTGGCTGTTCACAGG - Intergenic
1003091147 6:3104640-3104662 CAAGCAGAGAGGCTGGTCTCAGG + Intronic
1007534728 6:42576413-42576435 GCAGCAGAATGGCTGCATACAGG - Intronic
1007753476 6:44083894-44083916 GCAGCAGAGGGGCTGGGGCCAGG + Intergenic
1010007524 6:71011763-71011785 GGAGCAGGGGGGCTGGTCCCTGG + Intergenic
1011259231 6:85454215-85454237 GGAGCAGAATTGCTGGCCACAGG + Intronic
1011551793 6:88537140-88537162 CCAGCACAGTGGCTTGTGACAGG + Intergenic
1011651343 6:89509137-89509159 CCAGGAGAGAGGCAGGTCACTGG - Intronic
1013211708 6:107992606-107992628 GGAGTACAGTGGCTGTTCACAGG - Intergenic
1013422523 6:109979191-109979213 GCAGCAGGGGGGCCGGACACGGG + Exonic
1013981562 6:116136085-116136107 GCTGCAGAGTGGAGGGTCACAGG - Intronic
1016293427 6:142548726-142548748 GAAGGAGATTGGCTGGTCATTGG - Intergenic
1018105446 6:160482013-160482035 ACAGCAGAGAGGCTGGACACAGG + Intergenic
1018777184 6:167028312-167028334 GCTGCAGAGTTGCTGGGTACAGG + Intronic
1019322647 7:422653-422675 GCCGCAGAGTGCCTGGTTCCTGG - Intergenic
1019382373 7:730738-730760 GCAGCAGAGTGGCTGCCTAGGGG + Intronic
1022020979 7:26398967-26398989 GCGGCAGGGTGGCTGGTTTCTGG - Intergenic
1022640441 7:32177727-32177749 GAAGCACTGGGGCTGGTCACTGG - Intronic
1022706215 7:32804433-32804455 GAAGCAGAATTGCTGGTCAAAGG - Intergenic
1022956552 7:35386523-35386545 GTAGCTGAGTGGCTGCACACTGG + Intergenic
1023405167 7:39826298-39826320 TCAGGATAGGGGCTGGTCACTGG + Intergenic
1023771436 7:43560395-43560417 GCAGTAGAGTGTCTGGTCTTAGG - Intronic
1024217140 7:47257039-47257061 GCAGCAGAGGGGCTGGAAATGGG + Intergenic
1024683263 7:51716882-51716904 GCTGCAGTGTGGCTATTCACAGG - Intergenic
1026011636 7:66640788-66640810 GGAGCACAGTGGCTAGCCACAGG - Exonic
1032127597 7:129206061-129206083 GCAGCTGAGGGTCTGGGCACAGG + Intronic
1032510350 7:132467212-132467234 TCTGCAGAGTGGCTGGTCTTGGG + Intronic
1033172801 7:139098758-139098780 GCAGCAGGGGAGCTGGTCTCAGG - Intronic
1034834481 7:154339030-154339052 GCAGCAGACTGGCTGTGAACAGG + Intronic
1035294091 7:157858079-157858101 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294110 7:157858146-157858168 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294224 7:157858552-157858574 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294276 7:157858724-157858746 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294306 7:157858826-157858848 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294337 7:157858928-157858950 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294356 7:157858995-157859017 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294470 7:157859401-157859423 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1035294545 7:157859643-157859665 GCAGGAGTGTGGGTGGTGACGGG - Intronic
1037636566 8:20705611-20705633 GCAGCAGGCAGACTGGTCACCGG - Intergenic
1039092452 8:33846821-33846843 GGAGCACAGTGGCTATTCACAGG - Intergenic
1039117743 8:34111510-34111532 GCAGAAAGGTGGCTGGTAACAGG + Intergenic
1042135785 8:65631829-65631851 GTAGTAAAGTGGCTGTTCACAGG - Intronic
1042608919 8:70576891-70576913 GCAGCAGAGTGGCCAGGCAGTGG - Intronic
1042662919 8:71175567-71175589 GCAGCATGGTGGTAGGTCACTGG - Intergenic
1042799023 8:72697596-72697618 GGAGCACAGTGGCTATTCACAGG - Intronic
1044174650 8:89104370-89104392 GGAGCGTAGTGGCTGGTCATCGG + Intergenic
1046146168 8:110161672-110161694 GCAGCAGAGTTGCTGGAGAAAGG + Intergenic
1047158072 8:122344340-122344362 GGAGCAGAGTGGCTGGCTATGGG + Intergenic
1048460425 8:134616747-134616769 GCAGCACAGGGGCTGGTTAATGG + Intronic
1048970345 8:139641817-139641839 GCAGCAGTGTGGCTGAGGACTGG + Intronic
1049311123 8:141934453-141934475 CCAGCAAGGTGGCTGGTCAGAGG + Intergenic
1049820261 8:144629221-144629243 GCAGCAGGGTGAGTGGTGACTGG - Intergenic
1049851009 8:144830167-144830189 GCAGCAGAGGGCTTAGTCACAGG - Intronic
1051385571 9:16504805-16504827 GGAGTGGAGTGGCTGTTCACAGG - Intronic
1057185175 9:93053360-93053382 GCCGCCAAGTGCCTGGTCACTGG - Intergenic
1058606413 9:106728214-106728236 GGAGGAGGGAGGCTGGTCACAGG + Intergenic
1059247983 9:112864577-112864599 GCAGCAGAGGGGGTGCTCACAGG + Intronic
1059265806 9:113029329-113029351 GCAGCAAAGTGGCAGCTGACAGG - Intergenic
1059445690 9:114336594-114336616 GCCCCAGAGTGACTGGTCACAGG + Exonic
1059563153 9:115354899-115354921 GGAGCATAGTGGCTGGCCATTGG + Intronic
1060045543 9:120337318-120337340 CCAGGAGAGTGTGTGGTCACTGG - Intergenic
1060804195 9:126564463-126564485 GCTGGACAGTGGCTGGTGACAGG - Intergenic
1061064297 9:128267822-128267844 CCAGCACATTGGCTGGTCCCAGG + Intronic
1062418095 9:136463772-136463794 CCAGCAGGGTGGCTGCGCACTGG - Intronic
1185629428 X:1505315-1505337 GCAACAGAGGGCCTCGTCACCGG + Intronic
1190501443 X:51082602-51082624 GCAGCAGAGCCACTGATCACTGG + Intergenic
1192757612 X:74063074-74063096 GGAGCACAGTGACTGTTCACAGG - Intergenic
1193291372 X:79777117-79777139 GCAGCAGGGTGGCAGCTCAACGG + Intergenic
1194528945 X:95019630-95019652 GGAGCATAGTGGCTGGCCATTGG - Intergenic
1195045105 X:101048530-101048552 GCAGGAGAATGGCTTGACACAGG - Intronic
1199054375 X:143275426-143275448 GCAGCAGAATGGCTGGTGGGTGG - Intergenic
1200093509 X:153646914-153646936 GCGGCAGAGGGGCTGGGCTCTGG + Intronic