ID: 1104056802

View in Genome Browser
Species Human (GRCh38)
Location 12:125236882-125236904
Sequence TTTGGGTACCTGTAGTGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104056796_1104056802 2 Left 1104056796 12:125236857-125236879 CCAAAAGCAGACCCCAAGACAAA 0: 1
1: 2
2: 20
3: 82
4: 574
Right 1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG 0: 1
1: 1
2: 0
3: 7
4: 100
1104056800_1104056802 -10 Left 1104056800 12:125236869-125236891 CCCAAGACAAAGATTTGGGTACC 0: 1
1: 0
2: 3
3: 29
4: 252
Right 1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG 0: 1
1: 1
2: 0
3: 7
4: 100
1104056799_1104056802 -9 Left 1104056799 12:125236868-125236890 CCCCAAGACAAAGATTTGGGTAC 0: 1
1: 1
2: 1
3: 22
4: 169
Right 1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG 0: 1
1: 1
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104056802 Original CRISPR TTTGGGTACCTGTAGTGCAT CGG Intronic
907155365 1:52328898-52328920 TTTGGATACCTCTGGTGCTTTGG + Intronic
916639170 1:166708550-166708572 TTTTGGTACCAGTAGTGTAGAGG - Intergenic
921710976 1:218372729-218372751 GTTTGGTAGCTGTAGTGCAGAGG + Intronic
922806235 1:228391477-228391499 TCTGGGTGCCTGGAGTGCACGGG + Intergenic
923974003 1:239239131-239239153 ATTGGGTAGCTGTAGAGAATAGG + Intergenic
924605982 1:245535714-245535736 CTTTGGTACCTGTATTACATAGG + Intronic
1069286309 10:66720078-66720100 TTTAATTACCTGGAGTGCATGGG - Intronic
1069947514 10:71998248-71998270 GCTGGGTAACTGTGGTGCATTGG - Intronic
1070204490 10:74243020-74243042 TTTGGGTACCTGCACTCCGTGGG - Intronic
1071008630 10:80912253-80912275 TTTGTGTTCCTACAGTGCATTGG + Intergenic
1072906276 10:99457036-99457058 TTTGGATGCCTGGAGGGCATGGG - Intergenic
1073337157 10:102718410-102718432 TTTAGGTTCATGTAGAGCATGGG + Intronic
1077422561 11:2459827-2459849 TTTGGCCACCTGTGCTGCATGGG - Intronic
1077440561 11:2566888-2566910 GTTCTGTACCTGTAGTGGATGGG + Intronic
1080986052 11:37467479-37467501 TTAGGGTCCCTGTAGAGCATGGG + Intergenic
1080987454 11:37486114-37486136 TTTGGGTATCTGTAGGGTTTGGG - Intergenic
1086030974 11:82354984-82355006 ATTGAGTACCTGCAGTACATTGG - Intergenic
1087716258 11:101612364-101612386 TTTGTGTGCCTGTACTGCAAGGG + Intronic
1090766907 11:129884245-129884267 TTTTGGTACTTGTAGTTCACAGG - Intronic
1100812798 12:98356373-98356395 TTTGGGAACCAGTAGGGCCTGGG + Intergenic
1101255361 12:102971941-102971963 TTTTGGTCCCTGTAGTACCTGGG - Intergenic
1102207269 12:111099112-111099134 TTTGGGATCCTGTATTGAATGGG - Intronic
1104056802 12:125236882-125236904 TTTGGGTACCTGTAGTGCATCGG + Intronic
1105048636 12:133028154-133028176 TTTGGGGACCTGTGGTGTTTGGG + Intergenic
1108437018 13:50410772-50410794 TTTGGGTTACTGCAGTGAATAGG - Intronic
1111373994 13:87354429-87354451 TTTTGATACCTGAAGTGCTTTGG + Intergenic
1115423561 14:33226769-33226791 TTTAAGTATCTGTAGTGCTTTGG - Intronic
1117225256 14:53651848-53651870 TTTGGCAACCTGTGGTGCATAGG - Intergenic
1124350402 15:28951310-28951332 TTTGGGTATCTGTAAGGGATTGG - Intronic
1125936683 15:43642599-43642621 TTTGGGTTCCTGTTTTGCAAGGG - Intronic
1125949401 15:43738731-43738753 TTTGGGTTCCTGTTTTGCAAGGG - Intergenic
1126728265 15:51655219-51655241 TTTTGGTAACTGTAGGGGATGGG - Intergenic
1127688785 15:61374439-61374461 TTTGGATACCTGTGGTGGATAGG - Intergenic
1128040501 15:64568406-64568428 TTTGGGAACCTCTAGAGCAGTGG + Intronic
1129569168 15:76660350-76660372 TTTGGGCAGCTTTACTGCATAGG - Intronic
1130842378 15:87713103-87713125 TTTGGCTGCCTGTTGAGCATAGG - Intergenic
1134689119 16:16179419-16179441 TTTGGATACCTGTAGGGCAGTGG + Intronic
1136150194 16:28342682-28342704 TTTGGGTAATTGTTGTGCCTCGG + Exonic
1136166430 16:28456499-28456521 TTTGGGTAATTGTTGTGCCTCGG + Exonic
1136196543 16:28658533-28658555 TTTGGGTAATTGTTGTGCCTCGG - Exonic
1136212883 16:28772658-28772680 TTTGGGTAATTGTTGTGCCTCGG - Exonic
1136257609 16:29052577-29052599 TTTGGGTAATTGTTGTGCCTCGG - Exonic
1137425438 16:48375920-48375942 TTTGTGTGCCTGTAGTTCAGTGG - Intronic
1137690110 16:50420306-50420328 TTTGGTTTCCTTTAGTTCATTGG + Intergenic
1140367310 16:74391923-74391945 TTTGGGTAATTGTTGTGCCTCGG - Exonic
1143090276 17:4445886-4445908 TTTGGGAACCTGGAGTGGAGAGG + Intronic
1151161641 17:72171034-72171056 TGTGGGTAACTGTAAGGCATGGG - Intergenic
1152007697 17:77692908-77692930 GTTGGGTCCCTGTTGGGCATCGG - Intergenic
1154116912 18:11619455-11619477 TTTGGGTAATTGTTGTGCCTCGG + Intergenic
1156683457 18:39617945-39617967 TTTGGGAAGCTGAGGTGCATGGG - Intergenic
1160350890 18:78177276-78177298 CTTGGGAAACTGTAATGCATTGG - Intergenic
1162037568 19:7950182-7950204 TTTAGTTACCTGGAGTGCAGTGG - Intergenic
1164125655 19:22313846-22313868 TCTGGGTAGCTGTCCTGCATTGG - Exonic
1168612164 19:57810064-57810086 TTTTGTTACCTGGAGTGCAGTGG - Intronic
929109131 2:38391748-38391770 TTTGGGTATTTGTGGTGGATTGG - Intergenic
929479140 2:42285987-42286009 ATAGTGTACCTGTAGTGCATAGG + Intronic
932650801 2:73554017-73554039 ATTGGGGATCTGTAGTGGATAGG + Intronic
933377223 2:81495300-81495322 TTTCGTTAACTGTAGAGCATTGG - Intergenic
934591990 2:95561906-95561928 TTTGGGTACTTGGGGTGCAGTGG - Intergenic
944232871 2:197413359-197413381 CATGGGTAGCTGGAGTGCATTGG - Intronic
945105906 2:206314652-206314674 TTTGTGTACCTGTATTGAAAGGG + Intergenic
945989386 2:216381073-216381095 TTAGGGTGCATGTGGTGCATAGG - Intergenic
947207024 2:227670500-227670522 TTTAGGTTTCTGTAGTGCAGTGG + Intergenic
1174112956 20:48208692-48208714 TTTGAGTCCCTGTGTTGCATGGG - Intergenic
1177522989 21:22254332-22254354 TCTTGTTACCTGTAGTGGATTGG - Intergenic
1180718356 22:17887670-17887692 TTTTGGTAACTGTAGTAGATTGG - Intronic
1182791191 22:32954394-32954416 TTTTGCTACCTGCAGTGGATAGG + Intronic
952544600 3:34405323-34405345 TTTGGGCAGCTGTTGTGGATTGG + Intergenic
953360228 3:42289244-42289266 TTTGGAAACCTGTAGGGGATTGG - Intergenic
956907218 3:73778918-73778940 TTTGGGAAGCTGTATTACATTGG - Intergenic
963427504 3:145150746-145150768 TTTGGGTACCTATAGTGCATTGG + Intergenic
969631731 4:8343016-8343038 ATTGGGTGCCTGTAGTTCCTGGG - Intergenic
970089736 4:12391453-12391475 TTTTGGTATCTGTAGTGTACAGG + Intergenic
971559453 4:28057743-28057765 TCTGAGTACCTCTATTGCATTGG + Intergenic
974129546 4:57736664-57736686 TTTAGGTACCTGTTCAGCATAGG - Intergenic
976332037 4:83843590-83843612 ATTGAGTACCTGTCGTGTATAGG + Intergenic
981301450 4:143191158-143191180 TTTGGGAAAGTATAGTGCATGGG - Intronic
984723072 4:182994582-182994604 TTTGAGTTCCTCTAGTGCAGGGG - Intergenic
993440392 5:87949896-87949918 TCTGGGTACCATTAGTGCACTGG + Intergenic
1004955380 6:20723048-20723070 TCTGGGTACCTGCAGTTGATGGG - Intronic
1005580061 6:27225317-27225339 TTTGTGTACATGTAGTGGATAGG - Intergenic
1012549317 6:100453272-100453294 TTTGTGTCCCTGTAGTGCCCAGG - Intronic
1012810157 6:103946997-103947019 CTTGGGTACTGCTAGTGCATTGG + Intergenic
1030012013 7:105179465-105179487 TTTGGGCTACTGTAGTGAATCGG - Intronic
1031660452 7:124417591-124417613 TCTGAGTACCTGTGGGGCATTGG + Intergenic
1031708625 7:125015128-125015150 TTTTGGTACTTTTAGTTCATTGG + Intergenic
1032116847 7:129124781-129124803 TTTGGGGCCCTGGAGTGCCTTGG - Intergenic
1032930011 7:136655336-136655358 TTTGGGTAACTGAAGGGCAATGG + Intergenic
1035415719 7:158683897-158683919 TCTGAGTACCATTAGTGCATGGG - Intronic
1036202906 8:6784269-6784291 TTTGGGGACCTGCAGTGGGTTGG + Intergenic
1036211151 8:6842240-6842262 TTTGGGTAGCTGTAGGGAGTAGG + Intergenic
1037906583 8:22719120-22719142 TTTGGGTGCCTGTGGTGCTAGGG + Intronic
1038193031 8:25341275-25341297 ATTTGTCACCTGTAGTGCATTGG - Intronic
1045404734 8:101854405-101854427 ATTGCGTTCCTGAAGTGCATGGG + Intronic
1046162234 8:110381413-110381435 TTAGGGCAGTTGTAGTGCATTGG + Intergenic
1047004623 8:120607598-120607620 TTTAGGTATCTGTAGTACAAGGG - Intronic
1050541077 9:6670811-6670833 TTTGTGTTTCTGTAGTGCACTGG - Intergenic
1050792842 9:9495761-9495783 TTTGGGTACCTGCACTCAATGGG - Intronic
1051875518 9:21789009-21789031 TTAGAGTACTTGTAGTGCAAAGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1186043944 X:5513452-5513474 ATTGGGCCCCTGTAGTGCACAGG + Intergenic
1186311416 X:8323495-8323517 TCTGGGTACCTGCAGTCAATAGG - Intergenic
1192089583 X:68139780-68139802 GTTGGCTACCTGCAGTCCATTGG + Intronic
1195405989 X:104513923-104513945 TTTGGGTCACTGTATTGCTTTGG + Intergenic
1195935789 X:110124527-110124549 TCTGGGTCCCGGTACTGCATGGG + Intronic
1197261988 X:124329462-124329484 GTTGGGTAGCTGTATTGAATGGG + Intronic
1199991865 X:152991969-152991991 TTCGGGTGCCTGTAGTGAAAAGG + Exonic
1201447291 Y:14071582-14071604 TTTAGATACCTGTATTGCATTGG + Intergenic
1201500124 Y:14633160-14633182 TTTAGGTACATCTAGTCCATTGG + Intronic