ID: 1104058270

View in Genome Browser
Species Human (GRCh38)
Location 12:125246760-125246782
Sequence GTTCCTGTGGACAGAAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104058265_1104058270 9 Left 1104058265 12:125246728-125246750 CCGGCTTTCAGGCACCTATCTTC 0: 1
1: 0
2: 4
3: 16
4: 140
Right 1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG 0: 1
1: 0
2: 2
3: 22
4: 223
1104058266_1104058270 -5 Left 1104058266 12:125246742-125246764 CCTATCTTCTCACCCTTTGTTCC 0: 1
1: 0
2: 3
3: 28
4: 369
Right 1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG 0: 1
1: 0
2: 2
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104058270 Original CRISPR GTTCCTGTGGACAGAAGTGA TGG Intronic
902922514 1:19675147-19675169 GTTCCTGAGGCCAGAAATGATGG + Intronic
903056538 1:20640047-20640069 GGTGCTGAGGACATAAGTGATGG - Intronic
905279758 1:36841618-36841640 GGCCCTGGGGACAGGAGTGATGG - Intronic
905387460 1:37614407-37614429 GTGGGTGTGGACAGAAGGGAGGG - Intronic
905503429 1:38457089-38457111 GTTGCTGGGGACTTAAGTGAAGG - Intergenic
905838211 1:41149150-41149172 GTCCCAGAGGAGAGAAGTGATGG - Intronic
907510544 1:54954746-54954768 GTTTCTGAGGACAGAAGGGAGGG - Intergenic
909501081 1:76336708-76336730 GTTCCTGTCCACAGAGGTGCTGG - Intronic
909516420 1:76512261-76512283 TTACCTGTGGACAGCAGTGTGGG - Intronic
909711053 1:78649387-78649409 TTTCCTGTGGTCAGAAGAGAGGG + Intergenic
911314631 1:96341036-96341058 GTTCCTGTGGTCAGAAATTGAGG + Intergenic
914000227 1:143687853-143687875 CTTCCTCTGGACAGAAGAGATGG + Intergenic
914197532 1:145455882-145455904 CTTCCTCTGGACAGAAGAGGTGG + Intergenic
914476636 1:148028975-148028997 CTTCCTCTGGACAGAAGAGGTGG + Intergenic
916054572 1:161059525-161059547 GTTGCTGAGGACAGCAGAGATGG - Intronic
916557520 1:165906114-165906136 GTTCCTGAGGCCAGACGTGTAGG - Intronic
917020210 1:170578819-170578841 TTTCCTGTGAATACAAGTGAAGG + Intergenic
917805874 1:178613437-178613459 GTTGCTGTGGATTGAACTGAAGG + Intergenic
920266322 1:204726126-204726148 ATGCCTGTTGACAGAAGGGAAGG + Intergenic
921825060 1:219663214-219663236 TTTCATGTGGACAAAAATGAGGG - Intergenic
1063163109 10:3434195-3434217 TTTCATGTGGAGACAAGTGATGG - Intergenic
1063954548 10:11254326-11254348 GTGCGTGTGCACAGAAGTGCTGG - Intronic
1064509496 10:16074274-16074296 ATTACTGTGGCCAGAAGAGAGGG + Intergenic
1065896422 10:30166800-30166822 TTTCCTGTGGACAGAGGTTATGG + Intergenic
1065967456 10:30781362-30781384 TTTCCTGAGGGCAGAGGTGAAGG - Intergenic
1067178620 10:43968530-43968552 ATGCCTGTGGACAGGATTGAGGG + Intergenic
1067555116 10:47264145-47264167 GGTCATGTGGAAACAAGTGAAGG + Intergenic
1067769453 10:49112817-49112839 ATTCCTGTGGATAAAAGTTAAGG + Intronic
1067843571 10:49700857-49700879 TTTACTGTGGACAGGAGGGATGG - Intronic
1068493567 10:57755771-57755793 TTTCCTGAGGACAGATGTGGAGG - Intergenic
1068984370 10:63093702-63093724 GTTCCTCTGGACAGCCGTGTAGG - Intergenic
1069613482 10:69791133-69791155 GTTGCTGCTAACAGAAGTGATGG - Intergenic
1070710075 10:78674786-78674808 GTTCCAGGAGACAGAAGAGAGGG + Intergenic
1070730657 10:78825943-78825965 TTTGCTGTGGATGGAAGTGAAGG + Intergenic
1071203653 10:83249778-83249800 TTTCCTGTGTACAGTAGTCAGGG - Intergenic
1072732747 10:97858722-97858744 TTTCCTGTGGTGAGAAGTGCTGG + Intronic
1074524550 10:114252648-114252670 GCTGCTGTGGAGAGAGGTGAAGG - Intronic
1075274968 10:121085074-121085096 GACCCTTTGGACAGAAGAGAGGG - Intergenic
1076068759 10:127469390-127469412 GTACCTGTGGAAGGAGGTGATGG - Intergenic
1077246380 11:1541288-1541310 GTTCCTGGCCAGAGAAGTGAGGG + Intergenic
1078270266 11:9788436-9788458 CTTCCTCTGGTCAGAAGTGTGGG - Intronic
1083389875 11:62340459-62340481 GGTCCTGTGTAAATAAGTGAGGG - Intronic
1083789352 11:64974439-64974461 GTTCCTGAGGCCAGGCGTGATGG + Intergenic
1083850372 11:65362555-65362577 GTGCCTGTGGCCGCAAGTGAGGG + Intergenic
1083873086 11:65503359-65503381 GTTCCTGTGGGCTTCAGTGATGG + Intergenic
1084520025 11:69657340-69657362 GTTCCTGTGGACCGAGGCGGTGG - Intronic
1085277112 11:75307329-75307351 CTTCCTGAGGACAGAGGTCAGGG + Intronic
1089598753 11:119599925-119599947 GTGCATGTGAACAGAAGTGTGGG + Intergenic
1092600152 12:10051984-10052006 TTTCCAGTGGATAGAAGTCAAGG + Exonic
1092808262 12:12247850-12247872 GTTCCACTGAAGAGAAGTGATGG - Intronic
1096858583 12:54505480-54505502 TTGCCTGGGGCCAGAAGTGAAGG - Intronic
1097173691 12:57130696-57130718 GTTTCTGTGGAGAGCAGGGAAGG + Intronic
1100129833 12:91478062-91478084 GTTCCTGAAGACAGAATTAAGGG + Intergenic
1103769296 12:123308243-123308265 GTCTCTGTGGACAGAACTAAGGG - Intronic
1104058270 12:125246760-125246782 GTTCCTGTGGACAGAAGTGATGG + Intronic
1104725677 12:131074338-131074360 GCTCTGCTGGACAGAAGTGAAGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1109750947 13:66690757-66690779 TTTCCTGTGGAAAGAATTCAGGG - Intronic
1111259541 13:85718527-85718549 GTTCCTGAGGACATACATGATGG - Intergenic
1111606968 13:90551180-90551202 GTTTCAGTGGACAGAAGGGAAGG + Intergenic
1111961409 13:94814613-94814635 GTTTCTGTCTTCAGAAGTGAGGG + Intergenic
1112230388 13:97583818-97583840 GTTACAGTGGACAAAAGGGACGG + Intergenic
1115437582 14:33393129-33393151 GTACCTGTTGAGGGAAGTGAGGG + Intronic
1115514730 14:34174035-34174057 CTTCCAGTTCACAGAAGTGATGG - Intronic
1117462208 14:55956470-55956492 GTACCATTAGACAGAAGTGATGG + Intergenic
1117951035 14:61082814-61082836 GCTCCAGTGGACAGCAGAGAAGG - Intronic
1120739244 14:88089572-88089594 GTTTAAGTGGACAGAAGTAAGGG - Intergenic
1121582756 14:95043438-95043460 GTTCCCATGGACAGAAGAGACGG + Intergenic
1121941750 14:98077351-98077373 GTCCCTGTGGGCAGCAGAGAAGG - Intergenic
1122447613 14:101781278-101781300 GTCCCTGAGGACAGAAGCCAGGG - Intronic
1122541771 14:102501968-102501990 GTTCTTGAGGACAGAAGTGGAGG - Exonic
1122921134 14:104880664-104880686 GTAGGTGTGTACAGAAGTGAGGG - Intronic
1123035454 14:105470046-105470068 CTTCCTGTGGGCAGAGGTGGTGG - Exonic
1126466206 15:48963434-48963456 GTTCCTGTGTGCAGAACAGAAGG - Exonic
1128323824 15:66710376-66710398 CTTTCTGTGGACAGAAATTAGGG - Intronic
1128331188 15:66756806-66756828 TGTCCTCTGGACAGAGGTGAGGG + Intronic
1129234859 15:74217971-74217993 GTTGGGGTGGACAGAAATGAGGG + Intergenic
1129297974 15:74610228-74610250 GATCCTGTGGGTAGAAGGGATGG + Intronic
1130882219 15:88065214-88065236 GATCCTGTGGACAGAGGATAGGG - Intronic
1131064900 15:89428266-89428288 GTTCCACTGGACAGAAATGTAGG - Intergenic
1131916722 15:97274055-97274077 GTACCAGTGGGCAGAAGTCAAGG + Intergenic
1132078363 15:98842130-98842152 GCTTCTGGGGACAGAGGTGAAGG - Intronic
1132478332 16:153570-153592 GGTCCTGTGGCCAGAGGAGACGG + Intronic
1132480417 16:164160-164182 GGTCCTGTGGCCAGAGGAGACGG + Intronic
1132647713 16:1006802-1006824 GTTTCTGTGGACAGGAGGGACGG - Intergenic
1134318442 16:13140723-13140745 GAACATGTGGACAGCAGTGATGG + Intronic
1137389272 16:48067874-48067896 GTTCCTGAGGGGAGAAGTCAAGG + Intergenic
1138058277 16:53859169-53859191 GGAACTGTGGGCAGAAGTGATGG - Intronic
1142108243 16:88317745-88317767 GTTCCTGGGGACTCAAGTCACGG - Intergenic
1143496633 17:7316188-7316210 GTTCGGCTGGACTGAAGTGAGGG + Exonic
1143800597 17:9376924-9376946 GTCCCTGTGGCCAGAAGTTATGG + Intronic
1144354390 17:14430138-14430160 GTAAATGTGGACATAAGTGAAGG - Intergenic
1144591915 17:16531534-16531556 GTTCCTGTTGCCAGAAAAGAGGG + Intergenic
1149333486 17:55609961-55609983 GTCCCTGTGGTCAGCAGGGAGGG + Intergenic
1150034150 17:61775466-61775488 CTTCCTGTGGAAAAAAGAGAAGG + Intronic
1150634603 17:66904053-66904075 GCTCCTGGGGGCAGCAGTGAGGG + Intergenic
1151797821 17:76358165-76358187 GTACCTGAGGAGGGAAGTGAAGG + Intronic
1151827189 17:76530018-76530040 GTGCCTGTGAACAGAAGGGCCGG + Intronic
1152232508 17:79121159-79121181 ATCCCTGGGGACAGAAGGGAGGG - Intronic
1152900830 17:82940136-82940158 GTTCCTGGGAACAGCAGTGATGG + Intronic
1153224128 18:2884945-2884967 ATACCTGTGGACAGAAGGGATGG - Exonic
1153331953 18:3882588-3882610 GTTCTTGAGGACATGAGTGAAGG + Intronic
1153607743 18:6851871-6851893 GCTCCTGGGGACAGGAGGGAGGG + Intronic
1154428821 18:14292793-14292815 CTTCCTGGGAACAGAAGTCAGGG + Intergenic
1160183963 18:76660458-76660480 GTTCTTGTAGACAGATGGGAAGG - Intergenic
1161020941 19:2011231-2011253 GTTCCTGTGGCCAGGAGAGGAGG - Intronic
1161684292 19:5695434-5695456 GTTCCTGGGGACAGGACTGGGGG - Intronic
1161796038 19:6387350-6387372 GTGGCTGGGGACAGAAGTGAGGG - Intronic
1162708945 19:12577533-12577555 GTTCCTGGTGAGAGAAGCGAAGG + Exonic
1162834567 19:13307947-13307969 TTTCCTGGGGACAGAGATGATGG - Intronic
1163220286 19:15913906-15913928 GTTTCTGGGGGCAAAAGTGAGGG + Exonic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1166561392 19:43734473-43734495 GTTCCTGCAGACAGCAGAGATGG - Exonic
1166863578 19:45823227-45823249 TTGCCTGTGGTCAGAAGTCATGG - Intronic
925751293 2:7092013-7092035 ATCCCTGTGGACAGAACTCAGGG - Intergenic
926024171 2:9525609-9525631 GTTCTAGGGCACAGAAGTGAAGG - Intronic
926551379 2:14305684-14305706 GTTCCTTTTGAAAGATGTGAGGG - Intergenic
927626129 2:24720813-24720835 GTTCTAGTAGACAGTAGTGATGG - Intronic
928008710 2:27586770-27586792 GTGCCCGTGGACAGGAGTGGAGG - Intronic
928530642 2:32187424-32187446 GTTACTGTGGATAGAAGACAAGG + Intronic
929920647 2:46168978-46169000 GTTCGTGTGTATTGAAGTGAAGG + Intronic
931505645 2:62923266-62923288 GTTCCTCTGGCTGGAAGTGAGGG - Intronic
932422065 2:71607017-71607039 GTCCCTGTGTACAGAATTGCTGG + Intronic
934491276 2:94763240-94763262 GTCCCTGTGGACAGCTGGGATGG - Intergenic
934926262 2:98383596-98383618 ATCCCTGTGGACAGAAGTCGGGG + Intronic
935254556 2:101298078-101298100 GTTCCTGGGCACAGAATTGCTGG - Intronic
935933841 2:108159447-108159469 CTTCCTGTGGACAGAAGCTTTGG - Intergenic
936528731 2:113260253-113260275 CTACTTGTGGACAGAATTGAAGG - Intronic
938391781 2:130912321-130912343 GTCCCAGAGGAGAGAAGTGAAGG - Intronic
940346907 2:152637766-152637788 GTTCCTGTGGACAGCAGATCTGG + Intronic
945472129 2:210239261-210239283 GTTCTTGTGGCCAGAAGAGAGGG + Intergenic
945756446 2:213853135-213853157 GAGCCTGTGAACTGAAGTGAAGG + Intronic
945936607 2:215908657-215908679 GTTCCTGTTGTCTGAAGTTACGG - Intergenic
947484991 2:230539860-230539882 GTGCCTTTGGACAGAGGTGATGG + Intronic
947944751 2:234091965-234091987 CCTTCTGTGGACAGAAGTGCAGG + Intergenic
948902989 2:240965528-240965550 CTGCCTGTGGTCAGAAGGGAAGG + Intronic
1170495603 20:16921579-16921601 GGTCCTGTGGAACGAAGAGAAGG - Intergenic
1172782237 20:37443716-37443738 ACTCCTGTGCACAGAAGTGCTGG + Intergenic
1173635536 20:44553768-44553790 GTTCCTGTGCACACGGGTGAGGG + Intronic
1176993574 21:15527091-15527113 CTTCCTCTGGAAAGAAGGGAAGG - Intergenic
1178940580 21:36901959-36901981 GTGTCTGTGGACAGCAGTGGGGG + Intronic
1179371518 21:40810262-40810284 CTTCCTGTGCACAGACCTGAGGG - Intronic
1179836360 21:44036499-44036521 CTTTCTGTACACAGAAGTGATGG - Intronic
1181236344 22:21449845-21449867 GGTCCTGTGGCCAGAACTGACGG - Exonic
1182317988 22:29460359-29460381 GTGGCTGGGGACAGAAGAGAAGG + Intergenic
1184219274 22:43088909-43088931 GTACCTGTGGAGAGAACTCAGGG - Intronic
1184247289 22:43242112-43242134 GGTCCTTTGGGCTGAAGTGAGGG + Intronic
1185078548 22:48696416-48696438 GTTCCTGAGGAAAGGAGGGAGGG - Intronic
950248599 3:11444637-11444659 GTTCCTATGTCCAGAAGTAAGGG - Intronic
950557439 3:13704055-13704077 GGGAATGTGGACAGAAGTGAGGG + Intergenic
951599061 3:24352521-24352543 GTTCCTGTAGACATCTGTGAAGG - Intronic
951658524 3:25036256-25036278 TCTGCTGTGGACAGAACTGAGGG + Intergenic
951869531 3:27345716-27345738 GTTGCTGTGAACAGATGTGGTGG - Intronic
954491831 3:50913767-50913789 GTTCCTGTGCACTGAAGAGAGGG - Intronic
954847039 3:53568500-53568522 GTATCTGTGGACAGAAGAGTAGG - Intronic
955860151 3:63320574-63320596 ATTTCTGTGGACATAAGTGGGGG - Intronic
955927129 3:64018189-64018211 CTTCATGGGGACAGAAGTGAGGG - Intronic
957374998 3:79344384-79344406 TTTGCTGTGGAGAGAGGTGAAGG - Intronic
958141177 3:89564452-89564474 TTTCCTGTGGCCAGAAGTGGTGG + Intergenic
958666095 3:97139418-97139440 ATTCCTGCTGACAGAAGTGCAGG + Intronic
958710430 3:97710535-97710557 GTTTCCTTAGACAGAAGTGAAGG + Intronic
959820782 3:110732946-110732968 ATTCCTGTAGAGAGAAGAGAGGG - Intergenic
962188020 3:133280587-133280609 ATTCCTGTGGACACAAATAAAGG + Intronic
963064864 3:141255691-141255713 GCTCCTATGGAAAGAAGTGCAGG + Intronic
966176843 3:177147776-177147798 GTTCCTGTGGACATCAGGAATGG - Intronic
968962573 4:3752965-3752987 GTTCCAGGGGACAGAGGTGGAGG - Intergenic
974878608 4:67726850-67726872 CTTCCACTGGACAGAAATGATGG + Intergenic
977433256 4:96958868-96958890 TTTCCTCTGGACAGGAGTGCAGG + Intergenic
978631726 4:110754648-110754670 GTTGCTGTGTACAGAACAGAGGG + Intergenic
981545167 4:145886032-145886054 CTTCCTGAGGACAGAAGCCAAGG - Exonic
983345185 4:166520352-166520374 GTTCCTGGGAACTGAAGAGATGG + Intergenic
984680333 4:182601008-182601030 GTTTCTGTTGAGAGAAGTGATGG - Exonic
985075425 4:186209243-186209265 GTTCCTGGGGCCAGCAGAGAAGG - Exonic
986329657 5:6708327-6708349 CTTCCTGTGGACATGAGGGATGG + Intergenic
986809869 5:11345495-11345517 GTTCCTGTGTACTGTATTGAGGG - Intronic
987440005 5:17943855-17943877 TTTCCTGTGGATAGAAATTAAGG + Intergenic
990283323 5:54274943-54274965 ATTTCTGTGGGTAGAAGTGAGGG - Intronic
996467633 5:123821976-123821998 GTAACTGTTGACAGAAGAGAAGG - Intergenic
997109515 5:131059434-131059456 GTTGCAGTGGGCAGAAGTGTTGG + Intergenic
997242765 5:132320084-132320106 CTTCCTGTGGACAGCATGGATGG - Intronic
998505676 5:142670081-142670103 GTGCCAGTGTGCAGAAGTGACGG - Intronic
1000268441 5:159659942-159659964 GTTGGTGGGGAAAGAAGTGATGG + Intergenic
1000467058 5:161592622-161592644 GCTCCTTTTGACAGAATTGAAGG + Intronic
1000552558 5:162685066-162685088 GTTCCTATAGAAAGAAGAGAGGG + Intergenic
1002281837 5:178135094-178135116 TTTCCTGTGGTGAGAAGAGAGGG - Intronic
1002413897 5:179107940-179107962 CTGCCTGGGGACAGGAGTGAAGG + Intergenic
1002929293 6:1622314-1622336 GTTCCGGTGGTCAGAGGAGAGGG + Intergenic
1005998001 6:30943158-30943180 GGTCCTGTGGACAAACGTCAGGG - Intronic
1006275252 6:33000142-33000164 TTTCCAGTGGACGGAAGTGCCGG + Intergenic
1006521472 6:34573614-34573636 ATTCCTGGGGACAGGTGTGAGGG - Intergenic
1007664177 6:43504965-43504987 GTGCATGTGGACATGAGTGAGGG + Exonic
1008047179 6:46863267-46863289 GTTCATGTGGAAAGCAGAGAGGG - Intronic
1008426937 6:51369768-51369790 GTACCTGTGGATAGCAGAGAAGG - Intergenic
1008764227 6:54891782-54891804 GTGCCTGATGACAAAAGTGAAGG - Intronic
1011664317 6:89620189-89620211 TTTCCAGTCCACAGAAGTGAGGG - Intronic
1012475334 6:99610285-99610307 CTTCCTGTGGAAAGAAGTCTAGG + Intronic
1012975910 6:105780889-105780911 CTCCCTGTGGGCCGAAGTGATGG + Intergenic
1013274233 6:108568874-108568896 GTTTCTGTGGTAAGTAGTGATGG - Intronic
1013429416 6:110042569-110042591 GGTCCTGGTGTCAGAAGTGAGGG - Intergenic
1015031897 6:128604978-128605000 GTACTTATGGACAGAAGGGAAGG + Intergenic
1015966113 6:138696599-138696621 TCTCCTATGGACAGAAGTGCGGG + Intergenic
1020883341 7:13791994-13792016 GTTTCTGTGGACCAAAATGAAGG + Intergenic
1020934406 7:14443249-14443271 GTAACTTTGGAGAGAAGTGATGG - Intronic
1026162704 7:67883579-67883601 GTTCCAGGGGACAGGAATGAGGG + Intergenic
1026982241 7:74533576-74533598 GTGCCTGAGGACAGCACTGAAGG + Intronic
1027052018 7:75026500-75026522 GTTTCTGTGGTCAGAGGAGAAGG + Intergenic
1027907725 7:84207729-84207751 CTTCCTGTGGACATAGGTGTAGG + Intronic
1028227956 7:88271744-88271766 GCTCCTGTGGAGAGCAGTTAGGG - Intergenic
1029311169 7:99666391-99666413 GCTCCTGTGCACAGGAGAGAAGG + Intronic
1032438339 7:131920814-131920836 GTGACTGTGGCCAGAAGTGAGGG + Intergenic
1034213061 7:149381984-149382006 GTGCCTGTGGTCTGCAGTGAAGG - Intergenic
1034393504 7:150803070-150803092 GATCCTGTGGATAAAAGTCATGG - Intronic
1035635569 8:1141089-1141111 TGTCCTGTGGACAGTAATGATGG + Intergenic
1036237724 8:7055540-7055562 GAACCTGTGGAAAGAAGAGAGGG + Exonic
1036793800 8:11741188-11741210 GTGCTTGTGGCCAGAAGTGGTGG + Intronic
1038254599 8:25939817-25939839 GTTCCAGAGAACAGAAATGAGGG + Intronic
1038859262 8:31368305-31368327 GTTGCTGGGGCCTGAAGTGAGGG + Intergenic
1039441406 8:37597905-37597927 GTTCCTCAGCACAAAAGTGAAGG - Intergenic
1041548525 8:59074953-59074975 GTTCCTGTAAGCAGAACTGAAGG + Intronic
1042019483 8:64356058-64356080 TTTGCTCTGGGCAGAAGTGATGG - Intergenic
1042296935 8:67230013-67230035 GGTCCTGTGGACTGTTGTGATGG + Intronic
1043204493 8:77419930-77419952 TTTCCTATGGAAAGAAGAGAGGG - Intergenic
1044809821 8:96048313-96048335 GTTCTTTTGGATAGAAGTCATGG - Intergenic
1046074145 8:109297057-109297079 GTTTCTGTGGTCAGAAATCAGGG - Intronic
1046819668 8:118621599-118621621 GTTGCTTTGGAGAGACGTGAAGG - Intronic
1048115751 8:131520158-131520180 ATTATTGTGGAGAGAAGTGAGGG + Intergenic
1050812492 9:9766077-9766099 ATTCCTGAGGACAGTCGTGAAGG - Intronic
1052529830 9:29667886-29667908 GTTCATTTTGTCAGAAGTGAGGG - Intergenic
1052731969 9:32297343-32297365 TTTCCTGTGGAAATAAGTGAGGG + Intergenic
1054774591 9:69114606-69114628 GATCCTAGGGAAAGAAGTGAGGG + Intergenic
1056481187 9:87008009-87008031 GGGCCTGTGGACAGGAGAGATGG - Intergenic
1056791659 9:89629434-89629456 GTTCCTGGGGACGGAATAGACGG + Intergenic
1057930084 9:99185500-99185522 GTTTATTGGGACAGAAGTGAAGG - Intergenic
1057992046 9:99780898-99780920 GTGTCTGGGGAAAGAAGTGAAGG + Intergenic
1062172504 9:135143234-135143256 GTTCCTCTGAAGGGAAGTGAAGG + Intergenic
1062616588 9:137399358-137399380 GTTCCTGAGGACAGAACTGAGGG - Intronic
1187096070 X:16150052-16150074 GTACTTGTGGAGAGAAGAGAAGG + Intronic
1187724430 X:22187686-22187708 TTTCCTGAGGAAACAAGTGAAGG - Intronic
1188261602 X:28030915-28030937 GTTCCCGGGGACAGAATTTATGG + Intergenic
1189636685 X:43018141-43018163 TATCCTCTGGAAAGAAGTGAAGG - Intergenic
1192239230 X:69316102-69316124 GTTCCTGGGGAGAGAAAAGATGG - Intergenic
1192332658 X:70190318-70190340 GTTGCTCTGGAGAGATGTGATGG - Intronic
1193835997 X:86344629-86344651 GTGACTGTGGACAGAAGCAAAGG - Intronic
1196934473 X:120715924-120715946 GTTCCTGTGGAGAGGAATCAAGG + Intergenic
1197648687 X:129042407-129042429 GTGCATGTGGACATCAGTGAGGG - Intergenic
1199030763 X:142996416-142996438 GTTACTGTACACAGAAGTTAAGG - Intergenic
1200100143 X:153686101-153686123 GGTACTGGAGACAGAAGTGAAGG - Intronic
1200936271 Y:8741050-8741072 ATTCATGTGGACAGAACTGTTGG + Intergenic