ID: 1104061155

View in Genome Browser
Species Human (GRCh38)
Location 12:125269692-125269714
Sequence TATGTGTTAGGTTGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104061150_1104061155 9 Left 1104061150 12:125269660-125269682 CCAGCACGGAGCATGACTGATCA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 135
1104061147_1104061155 26 Left 1104061147 12:125269643-125269665 CCCTAGTTCAGTAGGATCCAGCA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 135
1104061148_1104061155 25 Left 1104061148 12:125269644-125269666 CCTAGTTCAGTAGGATCCAGCAC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104061155 Original CRISPR TATGTGTTAGGTTGGCTGCA GGG Intronic
900271685 1:1793354-1793376 TATGTATGAGGCTGGGTGCAAGG - Intronic
900541599 1:3205722-3205744 TATGTGTGAGGTTGGGGGCTGGG + Intronic
902240853 1:15088398-15088420 TATGTGTTGGGGTGGGTGGAAGG + Intronic
904859175 1:33521846-33521868 TATGTCATAGGGTGGCTGTAAGG + Intronic
905022439 1:34827104-34827126 GAGCTGTGAGGTTGGCTGCAGGG - Intronic
912372434 1:109184433-109184455 TATGTGTTAGGTGGAGTCCAAGG + Intronic
913065685 1:115252034-115252056 TTTCTGTTAGGTTTTCTGCATGG + Intergenic
917522176 1:175757351-175757373 TGTGTGTTTGGTTGGGTGGAAGG - Intergenic
917588567 1:176453714-176453736 TATGTGTCAGGTGAGGTGCATGG - Intergenic
917906108 1:179588432-179588454 CATGTGTCAGATTGACTGCAGGG - Intergenic
918004312 1:180527310-180527332 AATGTGTTAGGTAGACAGCAAGG + Intergenic
918508573 1:185284957-185284979 TGTGTGTGAGTGTGGCTGCAGGG - Intronic
920729922 1:208473825-208473847 TGTGTGTTTGTGTGGCTGCAGGG - Intergenic
921418027 1:214913234-214913256 TGGATGTTAGGTTGTCTGCATGG - Intergenic
921990813 1:221364712-221364734 TATGTCTTAGGTTGTCTTCCAGG - Intergenic
1063715698 10:8524352-8524374 TATGTGGTTGGTTGGCTCCTAGG + Intergenic
1064062992 10:12154909-12154931 CATGTGTGAGGTTGGGGGCATGG + Intronic
1064782083 10:18853045-18853067 AATGTGTTAGGTTAGATGCTAGG - Intergenic
1067216785 10:44310361-44310383 TCTGTGAAAGGTTGGCTGCCTGG + Intergenic
1068067983 10:52156482-52156504 TATGTGTGAGTTTGGTTGAATGG + Intronic
1069096366 10:64264342-64264364 TATGTGTTAAAGTGTCTGCAAGG + Intergenic
1077473347 11:2775106-2775128 TATGTGCTGGCTTGCCTGCAGGG + Intronic
1077488232 11:2848766-2848788 TGTGTGTTTGGCTGGCTGCTGGG - Exonic
1078254198 11:9643399-9643421 GATGTGTTAGGATGTTTGCAGGG - Intergenic
1079680402 11:23289714-23289736 TGTGTGTTTGGTTGGTTGCTTGG + Intergenic
1080883923 11:36348229-36348251 AAGGTGATAGCTTGGCTGCATGG + Intronic
1083288391 11:61675749-61675771 TATATTTTAGCTTGGCTGCAGGG - Intergenic
1086856496 11:91872156-91872178 TATGTGTTATCTAGGCTGGAGGG - Intergenic
1087258133 11:95979777-95979799 TATGTGTTAGGTTGATTACAAGG + Exonic
1087902941 11:103663101-103663123 TGTGTGTGTGGTTGGGTGCAGGG + Intergenic
1088495436 11:110427322-110427344 TTTGTGTTTGGTGGGCAGCAGGG - Intergenic
1092526958 12:9315278-9315300 TGTGTGTTAGGATGGCAGCCAGG - Intergenic
1093102565 12:15045579-15045601 TTTGTGATAGGTAGCCTGCATGG - Intergenic
1095040630 12:37436344-37436366 TATGTGCTTGGATGGCTTCATGG + Intergenic
1097048722 12:56207435-56207457 TATGTGTTTGGGTGGATGGAGGG - Intronic
1098307735 12:69118360-69118382 TATGTGATGGGTTTGCTGGAGGG - Intergenic
1098626749 12:72680947-72680969 TATTTGTTTGGTTGGATGAAGGG - Intergenic
1100163187 12:91885315-91885337 TAAGTGTTAGATTGGCTGACAGG + Intergenic
1100312476 12:93409711-93409733 TAGTTGTCAGGTTAGCTGCAGGG - Exonic
1102532384 12:113556123-113556145 TATGTGGTAGCTGGACTGCATGG + Intergenic
1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG + Intronic
1104766083 12:131331161-131331183 TATGTGGAAGGTTGGATGGATGG - Intergenic
1107377605 13:39821419-39821441 TATGTGTTTGATTGGCAGGAAGG + Intergenic
1108363153 13:49686021-49686043 CAGGTGTTAGGTGGGATGCATGG + Intronic
1109176352 13:59161534-59161556 TATGTCTTAGGTTGGCTGAGAGG - Intergenic
1111478305 13:88784261-88784283 TATTTCCTAGGTTGGCTTCAAGG + Intergenic
1112665926 13:101573090-101573112 TATCTGTTATGTTGTTTGCAAGG - Intronic
1114143493 14:19945391-19945413 TATTTGTTCTATTGGCTGCAGGG + Intergenic
1115044118 14:28969069-28969091 TATCTCTTAAATTGGCTGCATGG - Intergenic
1118660128 14:67999851-67999873 TATGTGTTAGATGGGTTCCAAGG + Intronic
1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG + Intronic
1121338976 14:93093848-93093870 GTTGTGTGAGGTTGGCTGCTGGG - Intronic
1123822274 15:24042937-24042959 TTTATGTTATGTTGTCTGCACGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1130058867 15:80555220-80555242 TATGTGCCAGGCAGGCTGCAAGG + Intronic
1131649849 15:94386959-94386981 TTTTTTTTAGGTTGGCTACAAGG - Intronic
1133376526 16:5291837-5291859 TGTGGGTTGGGTTGGCTGGAGGG + Intergenic
1133883935 16:9808514-9808536 TATGTGTTAGATAGAATGCAGGG + Intronic
1139111540 16:63897422-63897444 GATGCGTTGGGTAGGCTGCAGGG + Intergenic
1150537127 17:66054678-66054700 TAGGTGTGGGGTTGGATGCAGGG - Intronic
1151158320 17:72142978-72143000 TCTGTGTTGAGGTGGCTGCATGG + Intergenic
1152848508 17:82617272-82617294 TAGGTGTTAGGATGCCTGCTGGG - Intronic
1154461503 18:14593743-14593765 TATTTGTTCTATTGGCTGCAGGG + Intergenic
1157084115 18:44560223-44560245 TATATTTTAGGATGGGTGCAGGG + Intergenic
1157131231 18:45009176-45009198 ATTTTGTGAGGTTGGCTGCAGGG - Intronic
1157230103 18:45907550-45907572 GATGTGGGAGGTTGGTTGCATGG - Intronic
1158552412 18:58447306-58447328 GATGGGTTAGGTTTGCAGCAAGG + Intergenic
1161984796 19:7647283-7647305 TCTGTGTTAGGTGGGCGGCCTGG + Intronic
925693928 2:6554058-6554080 AATGTTTTAGTTTGGCTTCATGG - Intergenic
928557051 2:32437826-32437848 TATGTGTTAGGTTTCATGCTGGG + Intronic
929950336 2:46405345-46405367 TTTCTCTTACGTTGGCTGCAAGG - Intergenic
931760625 2:65413493-65413515 TCTGTGTTGTGTTGTCTGCAGGG + Intronic
938623366 2:133081489-133081511 CATTTGTTAGCTTGGATGCAAGG - Intronic
939815664 2:146893897-146893919 CATGTCATAGGTTGGCTGTAAGG - Intergenic
941035551 2:160564980-160565002 TATATGTTAGGGTGACTGCTTGG - Intergenic
942521382 2:176807713-176807735 TATGTGTTAGGTTCATTCCAGGG + Intergenic
942553732 2:177149171-177149193 TATTTTCTAGGTTGGCTGTAGGG - Intergenic
942949866 2:181710471-181710493 AATGTGTTTGCTTGGCTGTATGG - Intergenic
943053813 2:182949863-182949885 TATGTGTTAGGTCTGCAGCAAGG + Intronic
943271409 2:185810367-185810389 TATGTGTTGGGCAGGGTGCAGGG - Intronic
947525035 2:230872494-230872516 GATGGGTTAGGTTGGCTTCTTGG + Intronic
1171341951 20:24436783-24436805 AATGGGATATGTTGGCTGCAAGG + Intergenic
1171572686 20:26268942-26268964 TATGTGCTTGGATGGCTTCATGG - Intergenic
1171772947 20:29340249-29340271 GTTGTGATAAGTTGGCTGCAGGG + Intergenic
1171805874 20:29679936-29679958 TATGTGCTTGGATGGCTTCATGG - Intergenic
1171838189 20:30176499-30176521 TATGTGCTTGGATGGCTTCATGG + Intergenic
1172899610 20:38324912-38324934 TGTGTGTTATGTTGGGTGGAGGG - Intronic
1177757082 21:25361038-25361060 TAGGTACTAGGTTGGCTTCAGGG - Intergenic
1177942015 21:27422870-27422892 TTTCTCTTAGGTTGGGTGCATGG + Intergenic
1179654317 21:42835783-42835805 TTGGTGTTGGGTTGGCTCCAAGG - Intergenic
1182889238 22:33802888-33802910 TATGTGTTAGGCTGTGTTCAAGG - Intronic
1185064301 22:48623078-48623100 AATGTGTTCTGTGGGCTGCAGGG + Intronic
1185330442 22:50249836-50249858 TGTGTGCCAGGCTGGCTGCAGGG - Intronic
951512503 3:23519142-23519164 TGTATGTCAGGTTGGTTGCAAGG + Intronic
953124757 3:40080095-40080117 TGTGTGTGAGATTGGCTGTAGGG + Intronic
954777432 3:53032694-53032716 TCTGTGCTAGGTTGTGTGCAAGG + Intronic
955313764 3:57917500-57917522 CATGTGTTTGGCTGGCTGCCTGG - Intronic
959383803 3:105676163-105676185 TTTGTGTTTGCTTGGCTGCCAGG - Intronic
963097182 3:141556195-141556217 TATGTGTTAGGTAGGGAGCTGGG - Intronic
965606042 3:170498594-170498616 TATGTCTTAGGTTGGTCACAGGG + Intronic
966023009 3:175239264-175239286 CATGTGTAAGGTTAGCTTCAGGG + Intronic
968027316 3:195453304-195453326 TATCTGTTAGGGTGGCTGTTAGG + Intergenic
972381315 4:38522921-38522943 TCTGTGATAGGTTGCCTTCATGG + Intergenic
979291233 4:118981271-118981293 TATGAGACAGGTTGGTTGCAGGG - Intronic
985893267 5:2732897-2732919 CAGGTGTTGTGTTGGCTGCAGGG - Intergenic
995141295 5:108738232-108738254 TATGTATTAGATATGCTGCAGGG - Intergenic
995269317 5:110203452-110203474 TTTGAGTTTGGTTGGCTGGATGG - Intergenic
995753762 5:115480119-115480141 TATGTTTTAGGTTGGTTGTGGGG - Intergenic
998604825 5:143622857-143622879 TAAATTTTAAGTTGGCTGCAGGG - Intergenic
1002971546 6:2027260-2027282 TCTGTGTGAGACTGGCTGCATGG + Intronic
1003050531 6:2777021-2777043 TTTGTTTTAGGTTAGCTGTAAGG + Intronic
1004132823 6:12937171-12937193 TCTGTGTTAGGCTAGCTGCATGG + Intronic
1004132956 6:12938379-12938401 TCTATGTTAGGCTAGCTGCATGG + Intronic
1004135755 6:12964659-12964681 TATGTGTTAGGTGGAGTGAATGG + Intronic
1004987159 6:21095472-21095494 TAGGTGTTAGAATGGGTGCAAGG + Intronic
1005228226 6:23668163-23668185 TAAGTATAATGTTGGCTGCAGGG + Intergenic
1005835323 6:29704430-29704452 CCTGTGTTTGGTTGGTTGCAAGG + Intergenic
1010156436 6:72799412-72799434 TATGTGTCAGTTTGGCTAAATGG - Intronic
1013448743 6:110258093-110258115 TCTGTGTTAGGTTCTGTGCATGG - Intronic
1014770174 6:125451171-125451193 CAAGTGTTAGGCTGGCTGCATGG + Intergenic
1017946683 6:159101793-159101815 CATGTGTTAGCTCGTCTGCAGGG + Intergenic
1019208306 6:170381883-170381905 TATGTGTTACATTGGCTGTAGGG - Intronic
1019965013 7:4491437-4491459 GATGGGTTAGGTTTGCAGCATGG + Intergenic
1022647430 7:32244352-32244374 CATGTGTGATTTTGGCTGCATGG - Intronic
1025286678 7:57667978-57668000 TATGTGCTTGGATGGCTTCATGG + Intergenic
1027966588 7:85017857-85017879 TATGTGGAAGGTTGGCTGTTGGG + Intronic
1032687183 7:134246844-134246866 TATGTATTAGGTTTGCTTTAAGG + Intronic
1033156662 7:138962654-138962676 GCTGTGTTCGGTTGGCTCCAGGG - Intronic
1034293884 7:149954385-149954407 TTTTTGTTAGGTTGGGGGCAGGG - Intergenic
1034812183 7:154142474-154142496 TTTTTGTTAGGTTGGGGGCAGGG + Intronic
1036885151 8:12546721-12546743 TGTGGGTTGGGTTGGCTGGAGGG - Intergenic
1037001103 8:13719781-13719803 TACGTGTCAGGTTTTCTGCAGGG - Intergenic
1040459022 8:47629185-47629207 TATGTGTTAGGATGGTAGTAGGG + Intronic
1040585915 8:48741083-48741105 TATGTGTTAGGTCTGTTTCAGGG + Intergenic
1043689804 8:83136384-83136406 TATCTGTTAGCTTGGCTGCAGGG - Intergenic
1045248105 8:100460693-100460715 TATGTGTCAGGTTGGATGCCAGG + Intergenic
1046110164 8:109713335-109713357 TATGTGTTGGATTGGCATCAAGG - Intergenic
1048899579 8:139024603-139024625 TACTTGATAGGTTTGCTGCAAGG - Intergenic
1049413877 8:142486377-142486399 TGGGTTTAAGGTTGGCTGCAGGG - Intronic
1052001052 9:23281516-23281538 TCTGTGGTAAGTTGGCTTCAAGG - Intergenic
1053185795 9:36015170-36015192 TATGCATTATGTTGGTTGCATGG - Intergenic
1058114959 9:101074682-101074704 TATGTGGTAGGTTTTCTGCCAGG + Intronic
1060735777 9:126065926-126065948 TCTGTGTCAGGTTGGGTGCTGGG + Intergenic
1192219137 X:69185155-69185177 TATGTGTCAGGTTCTCTGCTGGG - Intergenic
1199107286 X:143884868-143884890 TAGTTGTCAGGTTAGCTGCAAGG + Intergenic
1202114540 Y:21458110-21458132 TATGTGGGAGGCTGGCTGTAAGG + Intergenic