ID: 1104062198

View in Genome Browser
Species Human (GRCh38)
Location 12:125277978-125278000
Sequence CACAACTGGGAGAAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104062198_1104062202 -1 Left 1104062198 12:125277978-125278000 CCAGCCTGCTTCTCCCAGTTGTG 0: 1
1: 0
2: 2
3: 35
4: 338
Right 1104062202 12:125278000-125278022 GTTTTGTGTCAAGACTCTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104062198 Original CRISPR CACAACTGGGAGAAGCAGGC TGG (reversed) Intronic
900329822 1:2128415-2128437 CTAAACTCGGAGCAGCAGGCTGG - Intronic
900351913 1:2238996-2239018 CACAACCCGGAGCACCAGGCAGG - Intronic
900534465 1:3170227-3170249 CACTCCTGGGGGAAGCAGCCAGG - Intronic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901107886 1:6771545-6771567 CACACCCAGGAGCAGCAGGCTGG - Intergenic
901820521 1:11826321-11826343 CCCGACTGGGAGAAGGGGGCGGG + Intronic
903060607 1:20666158-20666180 CACAACTGGGAGAGGCGTGAAGG - Intronic
903080210 1:20804929-20804951 CTCAATTGGGAGAAGCAGCCTGG - Intergenic
903771443 1:25766912-25766934 CACACCTGGCAGCAGGAGGCTGG - Intronic
903813384 1:26046896-26046918 CAAGCCTGGGAGATGCAGGCCGG + Intergenic
903848900 1:26294673-26294695 CCCAAGTGTGAGAAGGAGGCAGG + Intronic
904025837 1:27503197-27503219 GACAGCCGGGAGAGGCAGGCAGG + Intergenic
904594709 1:31636076-31636098 CACAACTCTGTGAGGCAGGCAGG + Intronic
904704215 1:32378160-32378182 CAACCCTGGGGGAAGCAGGCTGG - Intronic
906626531 1:47330399-47330421 CATAACTGGCAGAAGGAGACAGG + Intergenic
908703314 1:66924954-66924976 GACGACTGGAAGAAGGAGGCGGG + Exonic
911401367 1:97379251-97379273 GACAATGGGGAGAGGCAGGCAGG + Intronic
911869979 1:103085263-103085285 CTGAACTGGGATAAGCAGGTTGG - Intronic
913058685 1:115185040-115185062 CCATACTGGGAGAAGCAGGGCGG - Intergenic
913156052 1:116099532-116099554 CACTACTGGGAGGAGAAAGCAGG + Intergenic
913669132 1:121078912-121078934 GACAACTGGAAGCAGCAGGCAGG - Intergenic
914020877 1:143866309-143866331 GACAACTGGAAGCAGCAGGCAGG - Intergenic
914376488 1:147077761-147077783 CACGACTGGGGGAAGCGGGGAGG + Intergenic
914659373 1:149774251-149774273 GACAACTGGAAGCAGCAGGCAGG - Intergenic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
914951862 1:152122897-152122919 CACTCCTGGGAGACCCAGGCGGG + Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916758483 1:167795894-167795916 AACAACTGGGAGTGGAAGGCAGG + Intergenic
917123794 1:171668014-171668036 CACGACTGGAAGAAGGAGGAAGG + Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
917690310 1:177461825-177461847 CACAGATGGGTGAAGCAGGATGG - Intergenic
920035828 1:203064809-203064831 CACAAGTGAGAGAAGCAGGCTGG - Intronic
921589331 1:216985348-216985370 TACAACTCGGAGTAGCATGCTGG + Intronic
923842806 1:237692366-237692388 CACAGTTGAGAGAAGCAGGAGGG - Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062885289 10:1011393-1011415 CTCAGCTGAGAGAAGAAGGCAGG - Intronic
1062885294 10:1011516-1011538 CTCAGCTGAGAGAAGAAGGCAGG - Intronic
1063869281 10:10400711-10400733 CACAACTGGGAGGTGGATGCAGG + Intergenic
1064117112 10:12587625-12587647 CACAGCTGGAAGAAGAGGGCAGG + Intronic
1064691878 10:17926958-17926980 GAAACCTGGGAGAAGCAGCCAGG + Intergenic
1065830359 10:29609129-29609151 GACAACTGGGTGAACAAGGCAGG - Intronic
1069350946 10:67526582-67526604 AACAACTGAGTGAAGTAGGCAGG - Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1071508139 10:86245237-86245259 CAACTCTGGGAGAAGCAGGCGGG - Intronic
1071716294 10:88099652-88099674 CACAGCTGTGAGAAGCTGCCAGG - Intergenic
1071784928 10:88888401-88888423 AACAGGTGGGTGAAGCAGGCTGG + Intronic
1072631067 10:97146841-97146863 CACAAGTGGGGTTAGCAGGCTGG - Intronic
1075777758 10:124999170-124999192 CTCAACTGGGAGCCACAGGCTGG - Intronic
1076349621 10:129807162-129807184 CAGAACTGGGAGAAACAGCAAGG - Intergenic
1076478621 10:130769466-130769488 CACAACTGAGAGATGAAGGGAGG - Intergenic
1076883347 10:133250095-133250117 AACAACGGGGAGAAACAGGGAGG - Intergenic
1077161043 11:1113047-1113069 CACAGCAGGGAAGAGCAGGCAGG - Intergenic
1077190393 11:1253651-1253673 CAAAGCTGGGAGAGGCAGGAAGG - Intronic
1077328118 11:1972373-1972395 CACTGCTGGGAGAGGCAGCCAGG + Intronic
1077498009 11:2896062-2896084 CAGAACTGGGAAACTCAGGCAGG - Intronic
1077838620 11:5947641-5947663 TACATCTGGAGGAAGCAGGCAGG - Exonic
1077843769 11:6002679-6002701 AACATCTGGAGGAAGCAGGCTGG + Exonic
1077846200 11:6027379-6027401 AACATCTGGAGGAAGCAGGCAGG + Exonic
1078241437 11:9534303-9534325 TAAAAGTGGGAAAAGCAGGCTGG - Intergenic
1078508053 11:11966594-11966616 CTCACCTGGGAGAGGCAGGACGG + Intronic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1080451334 11:32381277-32381299 CACCGCTGGGCGGAGCAGGCAGG - Intergenic
1081436743 11:43035035-43035057 CACCACGGGGAGAGGCAGGTAGG + Intergenic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1081934444 11:46895287-46895309 CACATCTGGGAACACCAGGCAGG + Exonic
1083253680 11:61483632-61483654 TACAACAGGGAGAAGCAGGGAGG + Intronic
1083446994 11:62714827-62714849 CACAGCAGGTAGGAGCAGGCAGG - Exonic
1083923932 11:65794741-65794763 CACGGCTGGGAGGAGCACGCCGG + Intronic
1085462003 11:76699805-76699827 CACAGATGGGAGAAACAGCCAGG + Intergenic
1086435438 11:86775449-86775471 CACAACTGGAAGATGGCGGCAGG - Intergenic
1088920287 11:114255557-114255579 CACAACTCGGGGAAGTGGGCTGG - Intergenic
1089555743 11:119315259-119315281 CACACCTGGGGGAGGGAGGCGGG + Exonic
1089891030 11:121880915-121880937 TACATCTTGGAGAAGTAGGCAGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090274045 11:125407273-125407295 CACAAGGTGGAGAAGCAGCCAGG + Intronic
1090828307 11:130403384-130403406 CACAACCGGGAGAGCCAAGCTGG + Intergenic
1091326008 11:134688447-134688469 CATATCTGTGGGAAGCAGGCTGG - Intergenic
1202811097 11_KI270721v1_random:27553-27575 CACTGCTGGGAGAGGCAGCCAGG + Intergenic
1091562147 12:1622998-1623020 CACAGCGGGGAGAAACAGGATGG + Intronic
1092061100 12:5551240-5551262 GACAACCGTGAGAAGGAGGCAGG + Intronic
1092381537 12:8000763-8000785 CCCAAGTGGCAGAAGCAGCCTGG - Intergenic
1092735622 12:11579775-11579797 CTGAACTGGGAGAAGAAGGGTGG - Intergenic
1094415887 12:30214435-30214457 CATATCTGAGACAAGCAGGCTGG - Intergenic
1095436045 12:42189003-42189025 TACAACTGGGAGAATCAGAGTGG + Intronic
1096574052 12:52541568-52541590 TCCAGCTGGGGGAAGCAGGCAGG + Intergenic
1097806303 12:63968522-63968544 CCCAAATGAGAGATGCAGGCAGG - Intronic
1098135576 12:67398200-67398222 CACAGATGCCAGAAGCAGGCAGG - Intergenic
1098203973 12:68086384-68086406 CTCTCCTGGGAGAAGGAGGCAGG + Intergenic
1102791867 12:115653301-115653323 CACCATTGTGAGAAGCAGCCTGG + Intergenic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104579153 12:129997054-129997076 CCCAAATTGGACAAGCAGGCTGG - Intergenic
1104734764 12:131130078-131130100 CTCAACTAGGAGCAGCAAGCGGG - Intronic
1105303337 13:19153651-19153673 CACAACAGGAAGGAGCAGCCAGG + Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1108192182 13:47952969-47952991 AAAAACTGGGAGAATCAGGGTGG - Intronic
1109198230 13:59402628-59402650 CACAAAAGGAAAAAGCAGGCTGG + Intergenic
1109649667 13:65309825-65309847 CACACTTGGGAACAGCAGGCTGG + Intergenic
1111773502 13:92628733-92628755 CTCAACTCGGAGAAGGAGTCAGG - Intronic
1111790701 13:92851329-92851351 GCCAAATGGGAGAAGTAGGCTGG - Intronic
1112670004 13:101624647-101624669 CACCATTTGGAGAATCAGGCAGG + Intronic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1113963279 13:114137925-114137947 CACAACTGAGAGAAGCAGACAGG + Intergenic
1114445552 14:22785339-22785361 CACTACTGGTAGAAGCTGGGAGG - Intronic
1115509527 14:34126114-34126136 CACAAATTGGAGGAGCAGGTGGG + Intronic
1118231369 14:63953417-63953439 CAAAGATGAGAGAAGCAGGCAGG + Intronic
1118782018 14:69014857-69014879 TACTTCTGGGAGCAGCAGGCGGG - Intergenic
1119891181 14:78183370-78183392 CACAACTTGGGTGAGCAGGCAGG - Intergenic
1119956128 14:78800233-78800255 CAGAACTGGGAGTTGCATGCAGG - Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120756253 14:88247193-88247215 CACATCTGGGAAGGGCAGGCTGG + Intronic
1122932117 14:104938558-104938580 CACCACTGGCAGATGAAGGCAGG - Exonic
1122977348 14:105176299-105176321 CACAGCTGGGGGCCGCAGGCTGG + Intronic
1123439886 15:20282537-20282559 GTCCACTGGGAGATGCAGGCAGG + Intergenic
1125040936 15:35186570-35186592 CTCAGCTGGTAGAAGCAGGGTGG - Intergenic
1128109439 15:65067485-65067507 CACAAAGGGAAGAGGCAGGCAGG + Intronic
1128334964 15:66779867-66779889 CACAGCTCTGAGAAGCAGGCAGG - Intronic
1128451290 15:67807245-67807267 CACAACTGCGAGGAGCTAGCAGG - Intergenic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1129197812 15:73981603-73981625 CACAGCTGGAAGAGGCAGTCAGG - Exonic
1129267269 15:74400440-74400462 CACAGCAGAGAGAAGCAGTCAGG - Intergenic
1132274286 15:100553495-100553517 CACATCTGGAAGAAGCAGGAAGG - Intergenic
1132645051 16:995118-995140 CAGTCCTGGGAGAAGCAGGATGG + Intergenic
1133198808 16:4189878-4189900 CACAGCATGGAGGAGCAGGCAGG + Exonic
1133277419 16:4647197-4647219 CACATCTTGGAGGAGCAGGCAGG + Intronic
1133940089 16:10301999-10302021 AACTACTGGGAGAACCAGGAAGG + Intergenic
1134277715 16:12791624-12791646 CCCACCTGGGAGAAGGAGGCTGG + Intronic
1135524639 16:23205221-23205243 AACAACCGGGAGCACCAGGCAGG - Intronic
1135990954 16:27218488-27218510 CATACCTGGCAGAAACAGGCTGG - Intronic
1136609906 16:31359902-31359924 GAAAACTGGGAGAAGCACACAGG - Exonic
1136845283 16:33571860-33571882 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1136997750 16:35202398-35202420 TGAGACTGGGAGAAGCAGGCAGG + Intergenic
1137515198 16:49137411-49137433 CACAACTAGGCAAAGGAGGCAGG + Intergenic
1138251286 16:55503735-55503757 CACAAATGAGTAAAGCAGGCAGG + Intronic
1138539320 16:57678997-57679019 GACCACTGGGAGCAGCAGGGAGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1140237951 16:73175421-73175443 ACCAAGTTGGAGAAGCAGGCAGG - Intergenic
1140552885 16:75886588-75886610 AACAACTGGGAGAAGCAGAGAGG - Intergenic
1140975733 16:80058379-80058401 AACAACTCGCAGAAGCAAGCCGG + Intergenic
1141762563 16:86038502-86038524 CACCACTGTGACAAGCAGGGGGG - Intergenic
1203106991 16_KI270728v1_random:1420513-1420535 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1203155451 16_KI270728v1_random:1872158-1872180 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1143110379 17:4549478-4549500 TATAACTGGCAGAAACAGGCTGG + Intronic
1143366774 17:6413821-6413843 CACAGCTGGGACACGGAGGCTGG - Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1144823305 17:18090526-18090548 CACACCTGGGAGACTGAGGCAGG - Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145051517 17:19665682-19665704 CACATGTGGGAGAGGCAGGCAGG - Intronic
1146073408 17:29705071-29705093 AACAACTGGGAGAATGAGGCTGG - Intronic
1146794702 17:35773116-35773138 CCCAACTTGGAGAAGCAGTTTGG - Intronic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1147695427 17:42348820-42348842 CTAAACTGGGAGAAACAGGCTGG - Intronic
1149563825 17:57627964-57627986 CTCACCTGGGAGAAGCAGCGAGG + Intronic
1149606220 17:57927016-57927038 CGCAGCTGGGGGAAACAGGCCGG + Intronic
1149615650 17:57995682-57995704 CCCAACTGGAAAAAGCAGGCTGG + Intronic
1150226692 17:63528298-63528320 CAGGAGTGGGTGAAGCAGGCAGG + Intronic
1151023482 17:70648142-70648164 GACAAATGGGAGAAGAAAGCAGG + Intergenic
1151944729 17:77313315-77313337 GACAACGGGGAGAAGCAGCCCGG - Intronic
1152094704 17:78266374-78266396 CACACCTGGGAGGACCAGCCAGG - Intergenic
1152517999 17:80837333-80837355 CACACCAGGGAGCAGCAGGGGGG + Intronic
1152671794 17:81612441-81612463 CACAAATGGAAGAGGCATGCCGG + Intronic
1152784118 17:82239217-82239239 GCCACCTGGGAGCAGCAGGCGGG - Exonic
1153389932 18:4544798-4544820 ACCAACTGGGAAAAGCAGGTTGG + Intergenic
1153868680 18:9296978-9297000 CAGATCCGGGAGAAGCCGGCAGG - Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154111068 18:11568761-11568783 CTCCCCTGGGAGAAGAAGGCAGG - Intergenic
1154295574 18:13144109-13144131 CAGAACTGTGAGAAAAAGGCAGG - Intergenic
1155363521 18:25027909-25027931 GACACCTGGGAGAAGTGGGCTGG + Intergenic
1156186987 18:34674941-34674963 CACAGCTGGGAGGGGCAGGAAGG + Intronic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157486317 18:48089974-48089996 CAGAACTGGGTGAAGGAGGTGGG + Intronic
1157498379 18:48172332-48172354 CACAGCTTGGTGGAGCAGGCAGG + Intronic
1158443151 18:57495179-57495201 CACAACTTTGTGAACCAGGCAGG - Intergenic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1161445409 19:4316010-4316032 CACATCTGGGAGGTGGAGGCAGG - Intronic
1162066848 19:8131181-8131203 CACATCTGGTAGGGGCAGGCTGG + Intronic
1162854861 19:13460418-13460440 CCCAAGTGGGAGCAGAAGGCTGG - Intronic
1163127223 19:15250890-15250912 CAGACCTGGGTGGAGCAGGCTGG - Intronic
1163699178 19:18778645-18778667 CACCTCTGGGAGAGGCTGGCAGG - Exonic
1164015876 19:21255671-21255693 CAAGACTGGGAGAAGAAAGCTGG + Intronic
1164047407 19:21554656-21554678 CAAAACTGGATGGAGCAGGCTGG - Intronic
1164502506 19:28831640-28831662 CACAACTAGGAGAATCTGGAAGG + Intergenic
1165136186 19:33671009-33671031 GATGACTGGGAGAAGGAGGCTGG - Intronic
1165689039 19:37848634-37848656 CAAAAATGGGAAAAGCAGGCCGG + Intergenic
1167209064 19:48121826-48121848 AACAAATGGGAAACGCAGGCGGG + Intronic
1167667353 19:50830532-50830554 CCCAGCTGGGCGCAGCAGGCAGG + Intronic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
927677512 2:25117197-25117219 CACGCCTGGGAGCCGCAGGCAGG - Intronic
927695481 2:25236830-25236852 CACTAGCTGGAGAAGCAGGCGGG + Intronic
928706935 2:33960054-33960076 CAAAACTGGTAGCAGCAGGCAGG - Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929129669 2:38554701-38554723 CAGAGCTGGGATAAGCAGCCAGG + Intergenic
929533283 2:42765215-42765237 CATCCCTGGGAGAAGCAGGGTGG + Intergenic
929534071 2:42769753-42769775 CACCACAGGGAGCTGCAGGCAGG - Exonic
932368400 2:71167462-71167484 GACAACTGGAGGAAGAAGGCAGG + Intergenic
932710125 2:74056921-74056943 CACAACTTGGAGAAATGGGCTGG + Intronic
933811538 2:86035798-86035820 CCCAACTGGGGGAATCAGGGAGG - Intronic
934054270 2:88238965-88238987 CACAGCTTGGTGAAGCAGGCAGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
938421100 2:131147500-131147522 TAAAACTTGGAGAAGCTGGCTGG + Exonic
940196236 2:151097333-151097355 CCCAGCTGGGACATGCAGGCAGG + Intergenic
941043503 2:160648588-160648610 CAGAGCTGGCAGGAGCAGGCAGG + Intergenic
941326755 2:164124957-164124979 CTTAAATGAGAGAAGCAGGCTGG - Intergenic
942892953 2:181014332-181014354 TACAACTCAGAGAAGCAGCCTGG + Intronic
944384780 2:199151911-199151933 CACCCCTGGGAAAACCAGGCAGG - Intergenic
946523421 2:220491735-220491757 CCCAACAGGGAGAGGCAGGAAGG - Intergenic
948228664 2:236333864-236333886 CACAGCTCGGAGAAACTGGCAGG - Intronic
948575690 2:238948006-238948028 CAAAGCTGGGAGAGGCAGGAAGG + Intergenic
1169000491 20:2164517-2164539 CACATTTGGGGGAAGCAGGAAGG - Intronic
1170248149 20:14247036-14247058 AAAAACTGGGAGCAGCAGACAGG - Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1172099019 20:32474540-32474562 GACAACTGGGAGCAGGGGGCCGG + Intronic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1175117314 20:56691649-56691671 CACCACCGAGAGAAGCAGGAGGG + Intergenic
1175208476 20:57329969-57329991 CCCAACTGGGGGAAGCCGCCTGG + Exonic
1176072356 20:63233957-63233979 CTCCCCTGGAAGAAGCAGGCTGG + Intergenic
1176206523 20:63891627-63891649 CACCCTTGGGAGAGGCAGGCAGG + Intergenic
1176285856 21:5019134-5019156 CAGAGCTGGGAGAGGCAGGTAGG + Intergenic
1176659976 21:9624920-9624942 CACAATTTCGAGAAGCAGGCAGG - Intergenic
1179099628 21:38345324-38345346 CACAACTGACAGATCCAGGCAGG + Intergenic
1179820148 21:43932290-43932312 CAGAACTGGGAGGAGCACGGTGG - Intronic
1179871325 21:44244341-44244363 CAGAGCTGGGAGAGGCAGGTAGG - Intergenic
1179989488 21:44939852-44939874 CGCACCTGGGAGAAACAGACCGG - Intronic
1181112348 22:20609538-20609560 CACATCTTTGAGAAGCAAGCAGG - Intergenic
1181286366 22:21755218-21755240 CACAAGTGGAATCAGCAGGCAGG - Exonic
1181537779 22:23555651-23555673 CCCAAGTGAGAGAAGCAGCCAGG + Intergenic
1183358286 22:37370928-37370950 CACAACTGAGAAAAGCAAGCAGG - Exonic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183929256 22:41226795-41226817 CACCACTGACAGCAGCAGGCAGG - Intronic
1184696384 22:46141444-46141466 GTCCACTGGGAGACGCAGGCAGG + Intergenic
1184766441 22:46575015-46575037 CTCCACTGGGAGAAGCAGAGAGG + Intergenic
953637518 3:44675770-44675792 CACACCTGGGAGAAGCCGTGTGG + Intergenic
954436810 3:50500588-50500610 CATAACTGGAAAAAGGAGGCAGG + Intronic
955123304 3:56083685-56083707 CACAACTGGGAGAATGAAGTGGG + Intronic
955535087 3:59915085-59915107 CAGAACTGTGAGAAGCAGGTAGG + Intronic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
959708268 3:109359288-109359310 CAACACTGGGAGAATGAGGCAGG - Intergenic
961176092 3:124836067-124836089 CACATCTGGGAGATGCAGGGAGG - Intronic
962682864 3:137817631-137817653 CACACCTGGGTGAAGCAAGGAGG - Intergenic
963171595 3:142256802-142256824 CACAGCTGGGAGGAGCACCCTGG + Intergenic
963397195 3:144749895-144749917 CCGCACTGGGAGCAGCAGGCCGG + Intergenic
963666601 3:148196001-148196023 GAGAACTGGCAGAAGCAAGCTGG + Intergenic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
967466233 3:189808766-189808788 TACAACAGTGTGAAGCAGGCAGG - Intronic
967475145 3:189907919-189907941 GACATGTGGGAGAAGCAGGAAGG + Intergenic
968579020 4:1381123-1381145 CATAACTGGCAGAATCAGGAGGG + Intronic
968644165 4:1730648-1730670 CAGCTCTGGGAGAAGCAGGCTGG - Intronic
968867055 4:3219900-3219922 GAGTGCTGGGAGAAGCAGGCAGG - Intronic
969694388 4:8726374-8726396 CACAGCTGGGAGACACAGGGTGG - Intergenic
969699575 4:8760798-8760820 CACCACAGGGAGAAGCAGGGAGG - Intergenic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971457358 4:26857651-26857673 CGCACCTGGGGGAAGCCGGCAGG + Intergenic
973708283 4:53601302-53601324 CACAACTGGAAGGACCAGTCTGG - Intronic
975315284 4:72945206-72945228 CAAAACTTGGAGAATCAGGAGGG + Intergenic
975326306 4:73062580-73062602 CAGAACTGGGAGGCCCAGGCAGG + Intronic
977519741 4:98066340-98066362 CACAACTGGGAGGCTGAGGCGGG + Intronic
980043397 4:127964514-127964536 CCGCACTGGGAGCAGCAGGCCGG - Intronic
981085510 4:140679133-140679155 CACATCAGGCAGAAGCAGGGTGG + Exonic
981182049 4:141757479-141757501 CACAAATGTGAAAAACAGGCTGG - Intergenic
981782317 4:148443431-148443453 CATAAGTGGGAGAAACAGACAGG + Intronic
982532082 4:156558086-156558108 CACAACTGGTACATGCAGGTAGG + Intergenic
983244732 4:165274975-165274997 CACGCCTTGGAGAAGCAGGGTGG - Intronic
984534828 4:180961300-180961322 CACAACTGGCAGAGGCATTCAGG - Intergenic
985415397 4:189731486-189731508 CACACTTTCGAGAAGCAGGCAGG + Intergenic
985721788 5:1493340-1493362 CACAGCTGGGATAGGAAGGCTGG - Intronic
986964311 5:13252011-13252033 CACAACTGGGAGCAGCCTGTGGG + Intergenic
987122207 5:14778014-14778036 CACAAGTGGCAGAGGCAGGGAGG - Intronic
988872587 5:35407095-35407117 AACAAATAGTAGAAGCAGGCAGG + Intergenic
989718486 5:44494487-44494509 CTAAACTGGAATAAGCAGGCTGG - Intergenic
991288253 5:65005128-65005150 CAGTACTGGCAGTAGCAGGCAGG + Intronic
994047013 5:95321555-95321577 GCCAAGTGGAAGAAGCAGGCTGG - Intergenic
994966672 5:106681454-106681476 CAGAACTGGGACAACCAGGTGGG - Intergenic
995106580 5:108382217-108382239 CACTACGGGAAGAAGCCGGCCGG + Intergenic
995640491 5:114251216-114251238 TAACAATGGGAGAAGCAGGCTGG - Intergenic
1000239256 5:159394256-159394278 GACATCTGGGAGAAGCTGGGAGG - Intergenic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1001221614 5:169905167-169905189 CACAAGTGGGTGAAGCCAGCTGG + Intronic
1003378924 6:5604557-5604579 CAGAACTGTGAGCTGCAGGCAGG + Intronic
1003379834 6:5614311-5614333 CACACCTGGAACAATCAGGCGGG - Intronic
1003897026 6:10617293-10617315 CAGCACTCGGAGAAGCCGGCCGG - Intronic
1003985286 6:11428901-11428923 CACATCTCAGAGAAACAGGCTGG + Intergenic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1005407160 6:25501578-25501600 CACAAAGGGCTGAAGCAGGCAGG - Intronic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1006735219 6:36268541-36268563 GGCAGCTGGGAGGAGCAGGCAGG - Intronic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1007515263 6:42405857-42405879 CAAGACAGAGAGAAGCAGGCAGG + Intronic
1007834841 6:44666445-44666467 AACAGGTGGTAGAAGCAGGCAGG - Intergenic
1009418595 6:63441532-63441554 CACAAGTGGGAGAGGCAGCAGGG + Intergenic
1011906335 6:92373446-92373468 CACAACTGAGAGAAAAAGGCAGG - Intergenic
1014866827 6:126542595-126542617 AACAACTGGGTAAAGCAGGAAGG + Intergenic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1016045544 6:139476983-139477005 CACCACTGGGGGAAGAGGGCAGG - Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016936716 6:149453376-149453398 CACAACTGGGAGATTGAGGTGGG + Intronic
1017952531 6:159148312-159148334 CAGAGCTGGGACAAGAAGGCAGG + Intergenic
1019172065 6:170138202-170138224 CAGGACTGGGAGGAACAGGCGGG + Intergenic
1019219684 6:170463796-170463818 GACAACTGGGAGGAGGGGGCTGG + Intergenic
1019493485 7:1325660-1325682 GACATCTGGGAGAGTCAGGCCGG - Intergenic
1019596124 7:1859184-1859206 CACACCAGGGGGAGGCAGGCTGG - Intronic
1021479776 7:21103397-21103419 CAGAACTGTTAAAAGCAGGCAGG + Intergenic
1021496761 7:21283666-21283688 CACAGCTGTGAGAGTCAGGCCGG + Intergenic
1021601421 7:22367940-22367962 CAGAAATGGGAAAAGCTGGCTGG + Intergenic
1022333049 7:29398245-29398267 CACAACTGAGTGAAGAAGGGGGG - Intronic
1023592060 7:41790977-41790999 CAACACTGGGAGAAGAGGGCCGG - Intergenic
1023622199 7:42085346-42085368 CAAAACTAGCAGAAGCAGGTAGG + Intronic
1023765255 7:43504560-43504582 CAGAAGTGGGGGAAGCAGACAGG - Intronic
1024010021 7:45259363-45259385 CTCTCCTGGGAGGAGCAGGCAGG - Intergenic
1024569963 7:50715180-50715202 CACACCTGGGAGCCCCAGGCTGG - Intronic
1026516550 7:71078073-71078095 CCACACTGGGAGCAGCAGGCCGG + Intergenic
1027235030 7:76293077-76293099 CTCAACTGAGAGAGGAAGGCAGG - Intergenic
1028752309 7:94394758-94394780 CACAGCTGGGAGGAGCCTGCGGG - Exonic
1030300382 7:107968552-107968574 TAAAAGTGGGAGAGGCAGGCAGG + Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031118647 7:117695544-117695566 AACAATTGGGAGCAGCATGCTGG + Intronic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032943394 7:136822321-136822343 CACAACTCTGGGAAGCAGGAAGG + Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033648424 7:143322175-143322197 CACAACTGGGCGATGCAGCTGGG - Intronic
1034101122 7:148451433-148451455 CACAGGTGGGAGATGCAGCCAGG + Intergenic
1035011838 7:155725408-155725430 CACAACTGGGCGCAGGAGGGAGG + Intronic
1035630763 8:1105033-1105055 TCCACCTGGGAGAACCAGGCAGG + Intergenic
1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG + Intronic
1035770038 8:2139626-2139648 CGCAGCTTGGGGAAGCAGGCTGG - Intronic
1037235350 8:16713942-16713964 CTGAACTGGAATAAGCAGGCTGG - Intergenic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037617070 8:20529181-20529203 CCCAACTGGGAGAACAAGTCAGG - Intergenic
1037984983 8:23284875-23284897 TATCAGTGGGAGAAGCAGGCTGG - Intronic
1038983531 8:32784468-32784490 CACATCAGGGAGGACCAGGCTGG + Intergenic
1039517223 8:38144247-38144269 CACAGTTGGGAACAGCAGGCTGG + Exonic
1039553541 8:38460508-38460530 CACACCTGGGAGGAGGCGGCAGG - Intronic
1039580118 8:38658804-38658826 CCCAGCTGGGGGAAGAAGGCTGG - Intergenic
1040515524 8:48131054-48131076 CATCACTGGGAGAGGCGGGCAGG - Intergenic
1042175506 8:66034087-66034109 CACACCTGGGACAGGTAGGCAGG - Intronic
1042595745 8:70446227-70446249 GAGAACTGGGAGAAGCAGTAGGG + Intergenic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043291950 8:78613048-78613070 GGAAACTGGCAGAAGCAGGCAGG - Intergenic
1045950118 8:107841939-107841961 CACACCTGGGAGAAGCAAGAGGG + Intergenic
1049664672 8:143837607-143837629 CACCAGTGTGAGCAGCAGGCCGG - Exonic
1050229490 9:3505785-3505807 AACAAATGTGAGAAGCAGGGGGG - Intronic
1053359748 9:37476396-37476418 CAAAACTGACAGAACCAGGCCGG + Intergenic
1054731110 9:68704032-68704054 CACATCTGCAAGAAGCAGGCTGG + Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057215126 9:93223744-93223766 CAGACCTGGGAGTAGCAGGGAGG + Intronic
1059292143 9:113235658-113235680 CATGACTGGGAGAGGCAGGAGGG + Intronic
1061123561 9:128659247-128659269 CACAACTGGGAGGCCGAGGCGGG + Intergenic
1061376294 9:130226633-130226655 CATAGCTGGGAGGAGGAGGCTGG + Intronic
1062405786 9:136395598-136395620 CAGAACCGGGAGCAGCAGGTGGG - Exonic
1203637539 Un_KI270750v1:126764-126786 CACAATTTCGAGAAGCAGGCAGG - Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185764661 X:2715730-2715752 AAAAGCTGGGAGAAGCAGGAAGG - Intronic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1187376947 X:18764026-18764048 GTCAACTGGGAGAAGTAGGAGGG + Intronic
1192240100 X:69321870-69321892 CAGACCTGGGAGGGGCAGGCAGG - Intergenic
1192432389 X:71121229-71121251 CACAACTGGGGCAAGGTGGCAGG - Intronic
1193359101 X:80560055-80560077 CAGGACTGCGAGAAGCAGGGAGG - Intergenic
1194773351 X:97931943-97931965 CAGTACTGTGAGAAGCAGGAGGG + Intergenic
1194890497 X:99372313-99372335 CAGCACTCGGAGCAGCAGGCCGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195953465 X:110303314-110303336 CACAACTGGGGGAAAAAGTCAGG - Intronic
1195966456 X:110434198-110434220 CACCACTGGCAGCAGCAGGAGGG + Intronic
1197708000 X:129647758-129647780 CGCCACTGGGGGAAGCAGGCAGG + Exonic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1199678246 X:150205767-150205789 CTCAACTGAGAGAAGGATGCTGG - Intergenic
1199710547 X:150466095-150466117 CTCAACTGCGAGAAGTTGGCTGG - Intronic
1199766848 X:150947549-150947571 CAAAGCTGGGAGAGGCAGGAAGG - Intergenic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic