ID: 1104063851

View in Genome Browser
Species Human (GRCh38)
Location 12:125290044-125290066
Sequence TGCCGTGTGTGTTTTTCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104063846_1104063851 22 Left 1104063846 12:125289999-125290021 CCTTAAATCAAAGATATACCATG 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1104063845_1104063851 23 Left 1104063845 12:125289998-125290020 CCCTTAAATCAAAGATATACCAT 0: 1
1: 0
2: 3
3: 32
4: 266
Right 1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1104063843_1104063851 25 Left 1104063843 12:125289996-125290018 CCCCCTTAAATCAAAGATATACC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1104063848_1104063851 4 Left 1104063848 12:125290017-125290039 CCATGTCAGCAAGAGGAAGCCTG 0: 1
1: 0
2: 2
3: 30
4: 225
Right 1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG 0: 1
1: 0
2: 0
3: 14
4: 157
1104063844_1104063851 24 Left 1104063844 12:125289997-125290019 CCCCTTAAATCAAAGATATACCA 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104063851 Original CRISPR TGCCGTGTGTGTTTTTCTAG TGG Intronic
906737199 1:48141806-48141828 TGGCGTATGTCTTTTCCTAGAGG + Intergenic
914690446 1:150021257-150021279 TGACGTCTGTTTTTTTCCAGTGG + Intergenic
915839476 1:159203007-159203029 TGCTGTGTGTGTCTGTCCAGGGG + Intronic
916899942 1:169210784-169210806 TTCAGTGTGTGATTCTCTAGAGG - Intronic
917360726 1:174172951-174172973 TCCCTTGTGTTTTCTTCTAGGGG + Intronic
918137594 1:181688293-181688315 TACAGTGTATGTTTTTATAGAGG + Intronic
918959038 1:191246962-191246984 TCCTTTGTGTGTTTTTATAGTGG - Intergenic
919818420 1:201456715-201456737 TGCCCGGTCTGTTTTTCCAGTGG - Intergenic
921963366 1:221060173-221060195 TGCCTTGTTTGTTTATCTATTGG + Intergenic
922193611 1:223340879-223340901 TCAAGTGTGTCTTTTTCTAGAGG - Intronic
924418160 1:243881011-243881033 TGCCCTCTGAGTTTTTCTAAGGG - Intergenic
1064143810 10:12811708-12811730 AACCGTGTGTGTTTTTCTTTAGG - Intronic
1064500817 10:15971114-15971136 TTCAATGTGTGGTTTTCTAGAGG + Intergenic
1065102757 10:22346790-22346812 TTCCTTGTGTGTTTTTATTGGGG + Intronic
1067160366 10:43820071-43820093 AGCCCTGTGTGTTTTTCCATTGG + Intergenic
1072411104 10:95202757-95202779 TGCTTTGTGTTTTTTTTTAGTGG - Intronic
1076261065 10:129066832-129066854 TTCGGTGTGGATTTTTCTAGTGG - Intergenic
1082954939 11:58859714-58859736 TCTCCTGTGTTTTTTTCTAGTGG + Intronic
1084426653 11:69087694-69087716 TGCCGTGTAGATATTTCTAGTGG + Intronic
1087527411 11:99334254-99334276 AGTCCTGTGTGTATTTCTAGAGG - Intronic
1089095930 11:115919996-115920018 TGAAGTGTGTGTTTTTGAAGTGG - Intergenic
1090740518 11:129655271-129655293 TGTAAAGTGTGTTTTTCTAGTGG - Intergenic
1092290242 12:7156059-7156081 CGATGTGTGTATTTTTCTAGGGG + Intronic
1097298681 12:57995331-57995353 TGCCCTGTGTTTTCTTCTAAGGG + Intergenic
1098309722 12:69136404-69136426 TGCCATGTTTGATTTTCTAAAGG + Intergenic
1099924382 12:88999803-88999825 TGCCATTTGTGAGTTTCTAGGGG + Intergenic
1101484620 12:105141446-105141468 TCTCATGTGAGTTTTTCTAGGGG - Intronic
1101821697 12:108189324-108189346 TGCAGTGTGTATTTCTCCAGTGG - Intronic
1104063851 12:125290044-125290066 TGCCGTGTGTGTTTTTCTAGTGG + Intronic
1105013404 12:132770999-132771021 TGCCGTATTTTTTTTTCTAATGG + Exonic
1106228612 13:27803817-27803839 TTATGTGTGTGTTTTTCAAGAGG - Intergenic
1109421995 13:62125918-62125940 TGCGGTCTGGGTTTTTTTAGTGG + Intergenic
1110165860 13:72442358-72442380 TGGGGTGTGTGTGCTTCTAGTGG - Intergenic
1110890974 13:80697746-80697768 TGCCCTGTCTTTTTTTCTAATGG - Intergenic
1113418668 13:110152598-110152620 TGCAGTGTGTGGCTTTCCAGAGG - Intronic
1117306875 14:54486357-54486379 TGCCCAGTGTTTTCTTCTAGTGG - Intronic
1117362937 14:54996286-54996308 TGCCTTCTTTGTTTTTCTATTGG - Intronic
1118924234 14:70177361-70177383 TGAAGTGTGTGCTTCTCTAGAGG - Intronic
1119329510 14:73783634-73783656 AGCCCTGTGTGTATTTCAAGTGG + Intronic
1124200805 15:27677223-27677245 AGCCTTGTGTGTTTATCTTGTGG + Intergenic
1125917551 15:43502755-43502777 TGCCATTTGTTTTTTTCTTGAGG + Intronic
1126505947 15:49404860-49404882 TGATCTGTGTGTTTTTGTAGTGG + Intronic
1127596212 15:60485087-60485109 TGCAGTGTGTGTTTTATCAGAGG + Intergenic
1128151955 15:65368726-65368748 TGCCGCGTGTTTATCTCTAGAGG - Intronic
1129240153 15:74246217-74246239 TCCCCTGTGTTTTCTTCTAGGGG - Intronic
1129291685 15:74573095-74573117 TTCACTGTGTGTTTTTCTTGGGG + Intronic
1129866181 15:78910429-78910451 GTCAGTGTGTGTTGTTCTAGGGG - Intergenic
1132959413 16:2613626-2613648 TTTCGTGTGTGTTTTCCTAGAGG + Intergenic
1132972474 16:2695601-2695623 TTTCGTGTGTGTTTTCCTAGAGG + Intronic
1133822123 16:9246146-9246168 TGCAGTGTTTATTTTTCTTGGGG + Intergenic
1135664435 16:24324241-24324263 TGCCTTGCTTGTATTTCTAGTGG + Intronic
1136058689 16:27709762-27709784 TGCTCTGTGGGTTTTTCTTGGGG + Intronic
1138173362 16:54873816-54873838 TGCCCTTTGAGTTTTTCCAGTGG - Intergenic
1141109938 16:81263985-81264007 TGGAGGTTGTGTTTTTCTAGGGG + Intronic
1143879659 17:10020184-10020206 CCCCGTGAGTGATTTTCTAGGGG - Intronic
1144753071 17:17663408-17663430 TGGCCTGTGTGTTTGTGTAGGGG - Intergenic
1145230381 17:21169609-21169631 TGCAGTTAGTGTTTTTCAAGTGG + Intronic
1146707527 17:35012147-35012169 TGCCCTGTGTGTTTGTACAGGGG - Exonic
1148616217 17:49001935-49001957 TGTGGTGTGCCTTTTTCTAGAGG + Intronic
1149535790 17:57432388-57432410 TGCGGTGTGCATTTCTCTAGTGG + Intronic
1151675642 17:75596009-75596031 TCCTGTGTGTGTGTTTCAAGGGG + Intergenic
1157751016 18:50178505-50178527 TGCTTTTTGTGTTTTGCTAGGGG - Intronic
1157971679 18:52276962-52276984 TGCTGAGTGTGTTTTTCTGTAGG + Intergenic
1158307989 18:56127456-56127478 ACCCGTGTGTGTTTTACAAGAGG - Intergenic
1159709309 18:71734810-71734832 TTCTGTGTATATTTTTCTAGGGG - Intronic
1159942314 18:74417721-74417743 TGCAGTGTTTGCTTTTGTAGAGG + Intergenic
1163141764 19:15354315-15354337 TGCGGTGGGTGTGTTTCCAGTGG + Exonic
1164084983 19:21892934-21892956 TGCAGAGTGTGTTATTTTAGTGG - Intergenic
1164902499 19:31939956-31939978 TTCTGTGTGTGTTATTTTAGAGG - Intergenic
1165671836 19:37686505-37686527 TCCAGTCTGTGTTTTTCCAGAGG - Exonic
1166839399 19:45687456-45687478 AGCTCTGTGTTTTTTTCTAGTGG - Exonic
1167647194 19:50712134-50712156 TGTCATCTGTGTTTTTCTACTGG - Intronic
925298013 2:2791090-2791112 TCCCGTGTGTGTTTTCCATGGGG - Intergenic
928215616 2:29359176-29359198 TGCAGTGTTAGTTTTTCTAAAGG - Intronic
929651125 2:43680640-43680662 TGCAGTGTCTGTTTGTTTAGTGG + Intronic
937693692 2:124784235-124784257 TGCAGTCTGTGTTTTTCCAGGGG + Intronic
937871008 2:126786228-126786250 TGCTGTGTGTGTTTATCTTTGGG - Intergenic
939517935 2:143192409-143192431 TTCCTTGTGTGTTTATTTAGGGG - Intronic
940617400 2:156066385-156066407 TGCTGTGTGTGTTTGTGTAGTGG - Intergenic
941797825 2:169620179-169620201 TTCCGTGTGTTTTCTTTTAGTGG + Intronic
942049651 2:172127233-172127255 TGCGGAGTGAGTTTTGCTAGAGG + Intergenic
947916746 2:233837325-233837347 TGATGTGTGTGTTTTTTTTGGGG - Exonic
1168904177 20:1390931-1390953 TGAAGTGTGTGTTTTTCTCGCGG - Intronic
1170767117 20:19299748-19299770 TGACCTGTGTGTTATTTTAGGGG + Intronic
1170772908 20:19349628-19349650 TGCTCTGTGTGGTTTTCTGGAGG + Intronic
1177478806 21:21659411-21659433 TCCTGTGTATGTATTTCTAGAGG + Intergenic
1179126224 21:38593133-38593155 TGCTGTGTGTTTTGTTCTGGTGG - Intronic
1179926457 21:44537801-44537823 GGCTATGTGTGTTTTTCTTGTGG - Intronic
1180041282 21:45281606-45281628 TGCCCTGTGTGTGCCTCTAGAGG - Intronic
1180847457 22:18991712-18991734 TGCCATGGATGTGTTTCTAGGGG - Intergenic
1181006914 22:20017826-20017848 TGCCCAGTGGGCTTTTCTAGGGG + Intronic
1182410973 22:30185988-30186010 AACCTTGTGTGTTTTTCTTGGGG + Intergenic
1184897517 22:47419802-47419824 TGCCGTGTGTGTGTGTGGAGTGG + Intergenic
949204961 3:1427224-1427246 TGCTGTATATGTTTTTCCAGAGG - Intergenic
950463015 3:13136334-13136356 TTCCCTGTGTTTTCTTCTAGAGG - Intergenic
950894371 3:16434641-16434663 TTCTGTGTGTTTTTTTTTAGAGG - Intronic
953058874 3:39410361-39410383 TCCCATGTGTGTTTTTGCAGAGG + Intronic
953536064 3:43777766-43777788 TCCCGTGTGTGTTTTCCTAAAGG + Intergenic
954271048 3:49509428-49509450 TGATGTGTGTATCTTTCTAGGGG - Intronic
956159929 3:66339954-66339976 TTCCCTGTGTTTTCTTCTAGGGG + Intronic
956358222 3:68417438-68417460 TGCCATGTGAGCTTTTCAAGAGG - Intronic
956571039 3:70695324-70695346 TGCCCTAAGTGGTTTTCTAGTGG + Intergenic
962536936 3:136337978-136338000 AGATGTGTGTGTTTTTCTGGAGG - Exonic
964473565 3:157078691-157078713 TGCCCTGTGTTTTTGTCAAGTGG + Intergenic
965112441 3:164445220-164445242 TGCCATCTCTGTTTTTCTTGAGG + Intergenic
966339611 3:178911031-178911053 TGCCCTGTGTGCTTTTCAAGTGG + Intergenic
967589604 3:191258263-191258285 TTCAGTCTGTGTTTTTCAAGTGG + Intronic
969457394 4:7308016-7308038 TGCCCACTGTCTTTTTCTAGAGG + Intronic
972327440 4:38030344-38030366 TATCCTGTGTGTTGTTCTAGAGG + Intronic
973001682 4:44959799-44959821 TGCTATGTGTGTTTTTGTGGTGG + Intergenic
973983001 4:56322452-56322474 TTCCGTCTCTGTTTTTCTTGTGG - Intronic
974773975 4:66456065-66456087 TTCCCTATGTTTTTTTCTAGTGG - Intergenic
977858476 4:101925950-101925972 TGCCGTGTGTTTATTTCATGAGG - Intronic
978034704 4:103978145-103978167 TGGCTTATGTCTTTTTCTAGAGG + Intergenic
978487135 4:109268434-109268456 TAACTTGTGTGTTTCTCTAGAGG - Intronic
980049189 4:128021976-128021998 TGCGGTGTTTGGTTTTCTATCGG - Intronic
980833234 4:138156898-138156920 TGTGGTGTGTGTTTATGTAGAGG + Intergenic
983830937 4:172327993-172328015 TGATGTGTGTGTTTTTTTATTGG + Intronic
985038393 4:185864217-185864239 TGGCATGAGTGTTTTTCTTGAGG - Intronic
985425906 4:189829698-189829720 TGATGTGTGTTTTTCTCTAGGGG - Intergenic
986370859 5:7078593-7078615 TAGCATGTATGTTTTTCTAGTGG + Intergenic
991214126 5:64142153-64142175 TGCCCTGTGTTTTGTTCTAAGGG - Intergenic
991635594 5:68701597-68701619 TGCCCTTTTTCTTTTTCTAGAGG - Intergenic
993041615 5:82821300-82821322 TGCCTTCTGTGTTTTACAAGTGG - Intergenic
995034661 5:107519657-107519679 TGCAGTGTGTGCTTTCCAAGGGG - Intronic
995166022 5:109042630-109042652 TGCCCTTTGTGTCTTTCTAATGG - Intronic
995329525 5:110931919-110931941 TGGTCTGTGTGTTTTTGTAGTGG + Intergenic
996685459 5:126275309-126275331 TGCTGTGTGTTTTTTTTTGGCGG - Intergenic
996750045 5:126879176-126879198 TTCCATGTGTCCTTTTCTAGTGG - Intronic
1003612286 6:7624681-7624703 TTCTGTGTGAGTATTTCTAGGGG - Intergenic
1011845251 6:91554921-91554943 TGCCCTGTGGGTTTTTAAAGTGG + Intergenic
1011916242 6:92510166-92510188 TTCACTGTGTGTTTTTTTAGTGG - Intergenic
1013416771 6:109932579-109932601 TTCTTTTTGTGTTTTTCTAGAGG - Intergenic
1018578466 6:165284858-165284880 TGGTCTGTGTGTTTTTGTAGTGG - Intronic
1019502450 7:1371087-1371109 TGCGGTGTGTGTGGTTCCAGGGG - Intergenic
1020633738 7:10671930-10671952 TGGGGTGTGTGTTTTGCTAGGGG + Intergenic
1022627845 7:32056418-32056440 TGTCGTTTCTGTTTTTCTAAGGG + Intronic
1023386067 7:39659108-39659130 TTCGCTGTGTTTTTTTCTAGAGG - Intronic
1024875014 7:54011909-54011931 TCCCCTGTGTTTTCTTCTAGGGG + Intergenic
1026891340 7:73984605-73984627 TGCAGTGTGTGTCCTGCTAGGGG + Intergenic
1032089842 7:128905931-128905953 TGCAGTGTGTATTTTGCCAGAGG - Intronic
1032092403 7:128917600-128917622 TGCAGTGTGTATTTTGCCAGAGG + Intergenic
1036732865 8:11281659-11281681 TGGCTTATGTCTTTTTCTAGAGG - Intergenic
1041595342 8:59644148-59644170 TGCTGTTTGTGTTTTTCTTTTGG + Intergenic
1041703929 8:60824878-60824900 TGCTGTGTGTGATTTCCTAGTGG + Intronic
1046514125 8:115236862-115236884 TGCACTGTGTATTTTTCTGGGGG - Intergenic
1046667564 8:117021445-117021467 TGCAGTTTTTGTTTTTGTAGAGG - Intronic
1047874803 8:129123959-129123981 TGTTGTGTGTGTTTTTTTAAAGG + Intergenic
1050416291 9:5420759-5420781 TGCAGTGTGTGCTTTTAGAGAGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051210993 9:14743486-14743508 TGCCAAGTGTGTTTTTTTAAAGG - Intronic
1051731570 9:20148818-20148840 TGCCATGTGGGGTTTTCAAGGGG - Intergenic
1051801909 9:20944371-20944393 TGCCTTTTGTTTTTATCTAGGGG + Intronic
1051884376 9:21874938-21874960 TGCAGTGTTTGGTTTTCTATTGG + Intronic
1053663129 9:40298528-40298550 TTCCATGTGAGTTTTTCTAGAGG - Intronic
1053664582 9:40308615-40308637 TTCCAAGTGAGTTTTTCTAGAGG - Intronic
1053913634 9:42929058-42929080 TTCCATGTGAGTTTTTCTAGAGG - Intergenic
1054375253 9:64444752-64444774 TTCCATGTGAGTTTTTCTAGAGG - Intergenic
1054520032 9:66067669-66067691 TTCCAAGTGAGTTTTTCTAGAGG + Intergenic
1054521487 9:66077757-66077779 TTCCATGTGAGTTTTTCTAGAGG + Intergenic
1056256823 9:84808005-84808027 TGCCGTATGTGTTTTTATGGCGG + Intronic
1061725924 9:132582020-132582042 TGTTGTGTGTGTTTTTTTAAGGG - Intergenic
1062704800 9:137932035-137932057 TGGCTTATGTCTTTTTCTAGAGG - Intronic
1186874379 X:13802893-13802915 TGCCGTGTGGGTTCTGCTGGTGG - Intronic
1189041672 X:37547813-37547835 TTCAGTGTGTGTTTTTCTCTGGG - Intronic
1192036622 X:67569510-67569532 TACCCTGTGTGCTTTGCTAGTGG + Intronic
1193479360 X:82008835-82008857 TTAAGTGTGTGTTTTTGTAGTGG + Intergenic
1197434040 X:126402801-126402823 TTTCTTGTGTGTTTTTCTAAAGG - Intergenic
1197444699 X:126537099-126537121 TGCTGTGTATGCTTTTCAAGTGG + Intergenic
1199410724 X:147519327-147519349 TCACCAGTGTGTTTTTCTAGTGG - Intergenic
1200135676 X:153873474-153873496 TGCCCTGTGTGTCTATCCAGTGG - Intronic
1201250395 Y:12052117-12052139 TGCCGTGTATATTTTTCAAAGGG - Intergenic