ID: 1104067094

View in Genome Browser
Species Human (GRCh38)
Location 12:125315089-125315111
Sequence CCTTCTGTGCATAAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104067094_1104067098 -10 Left 1104067094 12:125315089-125315111 CCAGGCAGCTTATGCACAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1104067098 12:125315102-125315124 GCACAGAAGGAAGTAGGTTAGGG 0: 1
1: 0
2: 2
3: 8
4: 209
1104067094_1104067100 -4 Left 1104067094 12:125315089-125315111 CCAGGCAGCTTATGCACAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1104067100 12:125315108-125315130 AAGGAAGTAGGTTAGGGGTTAGG 0: 1
1: 0
2: 0
3: 21
4: 280
1104067094_1104067101 -3 Left 1104067094 12:125315089-125315111 CCAGGCAGCTTATGCACAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1104067101 12:125315109-125315131 AGGAAGTAGGTTAGGGGTTAGGG 0: 1
1: 0
2: 0
3: 24
4: 249
1104067094_1104067099 -9 Left 1104067094 12:125315089-125315111 CCAGGCAGCTTATGCACAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1104067099 12:125315103-125315125 CACAGAAGGAAGTAGGTTAGGGG 0: 1
1: 0
2: 4
3: 16
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104067094 Original CRISPR CCTTCTGTGCATAAGCTGCC TGG (reversed) Intronic
901267393 1:7922040-7922062 CGATCTGTGCGTGAGCTGCCAGG + Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
906684745 1:47756130-47756152 TCCTCTGTTCTTAAGCTGCCTGG + Intergenic
908928427 1:69285871-69285893 CCATTTCTGCATAAACTGCCTGG + Intergenic
909075534 1:71047292-71047314 CCTGCTGTGCATCGGCTGGCTGG - Exonic
909227497 1:73044382-73044404 AGTTCTGAGCACAAGCTGCCTGG + Intergenic
910779931 1:90919947-90919969 GTTTCTGTACATAAGCTGGCTGG - Intronic
913200469 1:116492148-116492170 TCTTCTGTTCATAACCTACCTGG + Intergenic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
916556553 1:165898835-165898857 CCTTCTCTGAACAGGCTGCCTGG + Intronic
924064149 1:240207084-240207106 CCTCCTGTGGATGGGCTGCCAGG + Exonic
1062916565 10:1244776-1244798 CCACCTGTGCAGAAGCTCCCTGG - Intronic
1064803951 10:19109590-19109612 ACTTCTGTGAATAAATTGCCAGG - Intronic
1067338664 10:45383693-45383715 CCTGCTGTTCTTAAGCTACCAGG + Intronic
1067673378 10:48346847-48346869 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1067685037 10:48461613-48461635 CCTTCTTTGCCTGGGCTGCCAGG - Intronic
1072425207 10:95324281-95324303 CCCTCTGAGCATCAGCTTCCTGG - Intronic
1073323096 10:102627594-102627616 CGTTCTGTTCAGAATCTGCCAGG - Intronic
1077211096 11:1371310-1371332 CCATCTGTGCACAGGCTCCCCGG + Intergenic
1082580093 11:54855646-54855668 CCTTCTCTGCCTTGGCTGCCAGG + Intergenic
1083467108 11:62855738-62855760 CCTTCTGTGTTGTAGCTGCCTGG - Intergenic
1090664144 11:128903837-128903859 TCCGCTGTGCACAAGCTGCCCGG - Intronic
1093688135 12:22079155-22079177 CTTTCTGTGGCTAAGCTTCCTGG + Intronic
1095410112 12:41912158-41912180 CCTTCTGTCCAGAGGCTGACTGG - Intergenic
1097089975 12:56497282-56497304 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1097090532 12:56500988-56501010 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1105856364 13:24376090-24376112 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1105980944 13:25515497-25515519 CCTTCTGAGTATGAGCTGCAGGG - Intronic
1109091829 13:58056504-58056526 CCTTCTGAGCATAAACTTTCAGG - Intergenic
1110803148 13:79723888-79723910 CCTTCTGTGGCCATGCTGCCAGG - Intergenic
1113900638 13:113794917-113794939 CCTTCCGTGCAGAAGGCGCCTGG + Intronic
1117351913 14:54889597-54889619 ACTTCTGTGAACAAGCAGCCAGG - Intronic
1120914430 14:89698232-89698254 CATGCTGTGCATGAGCTTCCCGG + Intergenic
1121929632 14:97960625-97960647 CCTTCTGCGCTTGGGCTGCCAGG + Intronic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1124220716 15:27847628-27847650 ACATCTGTGCAGAACCTGCCAGG - Intronic
1125087284 15:35745185-35745207 CCTTTTGACCATAGGCTGCCTGG - Intergenic
1129069899 15:72942058-72942080 CCTGGTGTGGAGAAGCTGCCCGG + Intergenic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1131629849 15:94165145-94165167 CCTTCTGTGCACAAGCTCATTGG + Intergenic
1131918679 15:97300128-97300150 CCTTCTGTACAAAAGCTACTTGG - Intergenic
1132044773 15:98554386-98554408 CCTTCTATGTTTATGCTGCCTGG - Intergenic
1135464514 16:22673684-22673706 ACTGCTGTTTATAAGCTGCCTGG + Intergenic
1135805061 16:25535086-25535108 CCTTGTTTGCATTATCTGCCTGG + Intergenic
1136295011 16:29296528-29296550 GCTTCTGTGCCTGAGCTTCCTGG + Intergenic
1136352690 16:29721357-29721379 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1137359824 16:47804051-47804073 CCATCTTTGCTTAAGCTGCTTGG - Intergenic
1137671089 16:50279660-50279682 CCTTCTGTGCACCAGGTGCCAGG - Intronic
1138660117 16:58511820-58511842 CCTTCTGTGCCTGGGCCGCCGGG - Exonic
1139170762 16:64627392-64627414 CATTCTGAGCACAGGCTGCCTGG - Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1140976647 16:80065954-80065976 CTTTCTTTGCCTTAGCTGCCAGG + Intergenic
1142205605 16:88781552-88781574 CCTTCTGAGCATCAGCTCCCTGG - Intronic
1142384321 16:89753157-89753179 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1143030722 17:3965461-3965483 CCTTCTGTGCCTCTGCAGCCAGG + Intergenic
1144404285 17:14937581-14937603 CCTTCTGTACATAGGCTGAAGGG + Intergenic
1144788809 17:17846332-17846354 CCTTCTGAGCAACAGCAGCCTGG + Intronic
1145732028 17:27198127-27198149 CCCTCTCTGCCTCAGCTGCCAGG + Intergenic
1146305644 17:31727999-31728021 CCTTCTGTGTACAGACTGCCTGG + Intergenic
1146470519 17:33120835-33120857 CCTTCTGTACACCAGCTACCAGG - Intronic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1151344852 17:73495204-73495226 CCTTCTGTGCATAGGTGCCCTGG - Intronic
1152568127 17:81109230-81109252 CCTTTTGAGCAGAAACTGCCAGG + Intronic
1153471807 18:5454538-5454560 CCCTCTATGAATATGCTGCCTGG - Intronic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
1155178844 18:23325474-23325496 CCTTCTTTGCTTTGGCTGCCAGG - Intronic
1157399379 18:47374358-47374380 CCTTCTCTGCATGGCCTGCCAGG - Intergenic
1157498016 18:48170372-48170394 CCTTCTCTGGAGAGGCTGCCAGG - Intronic
1157645815 18:49269630-49269652 CCTTCTTTGTATATGCTGTCTGG - Intronic
1160354042 18:78211275-78211297 TCTTCTGTGCATTTTCTGCCTGG + Intergenic
1162849857 19:13422596-13422618 CATTGTGAGCATAAGCTACCAGG - Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163684183 19:18701276-18701298 CCTTCTGTGCCTCAGTTTCCTGG + Intronic
1163843779 19:19627717-19627739 CCTTGTGTGCACACGCTCCCGGG - Intronic
1164083473 19:21880533-21880555 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1164084627 19:21889803-21889825 CCCTCTCTGCCTCAGCTGCCAGG - Intergenic
1164261566 19:23572396-23572418 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
1166456224 19:42942186-42942208 CTTTCTCTGCTTCAGCTGCCAGG - Intronic
927998266 2:27501846-27501868 GGTTCTGTGCATGAGCTGCCTGG + Intronic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
928381291 2:30821110-30821132 CCCTCTCTTCATATGCTGCCAGG + Intergenic
929595008 2:43170349-43170371 CCTTCTGTGAATAAACTCTCAGG + Intergenic
931919194 2:66994545-66994567 CATTCTGTGAATATGCTGCCAGG + Intergenic
931991871 2:67798443-67798465 CATTCTTTGCATAAGCTCTCTGG - Intergenic
932388611 2:71362910-71362932 ACTTCTGTGCATATGCTGGCCGG + Intronic
935224025 2:101037975-101037997 CCTCCTGTCCATAAGCTGAGGGG - Intronic
935640377 2:105284384-105284406 CCTTCTGTACATTACCTGCAAGG + Exonic
935687802 2:105699324-105699346 CGTTGTGTGAAAAAGCTGCCTGG - Intergenic
936166236 2:110122126-110122148 CCTTTTGCCCATCAGCTGCCTGG - Intergenic
938491144 2:131761937-131761959 TCTTGTGTGCATCAGGTGCCAGG - Intronic
938496420 2:131800400-131800422 TCTTGTGTGCATCAGGTGCCAGG + Intronic
938772454 2:134512084-134512106 CCTGCTGTGCATTAGCTACGAGG + Intronic
942189685 2:173457466-173457488 CCTCCTTTGCAAAAGCTTCCCGG + Intergenic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
944853419 2:203743363-203743385 CCTTCTGTGCATTTGTTTCCTGG - Intergenic
945510815 2:210700646-210700668 CTTTCTGTGGATATCCTGCCTGG - Intergenic
947628247 2:231634767-231634789 CCTTTTATGGAAAAGCTGCCAGG - Intergenic
948809516 2:240467525-240467547 CCTCCTGTGCCCCAGCTGCCAGG + Exonic
1172601526 20:36187161-36187183 CCTTCTTTGCTTTGGCTGCCAGG - Intronic
1173742674 20:45412461-45412483 CCTTCTGTGCAAAAGCCTCTAGG + Intergenic
1176109154 20:63403313-63403335 CCTGCTGAGTGTAAGCTGCCTGG - Intergenic
1178935829 21:36860834-36860856 CCTACTGTGGAGAAACTGCCTGG - Intronic
1179775533 21:43659556-43659578 CCTTCTGTGCAGTCGCGGCCCGG + Exonic
1179916134 21:44479378-44479400 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1184344408 22:43904202-43904224 CCTTCTCTGCCTCGGCTGCCAGG - Intergenic
1184500770 22:44870299-44870321 ACTTCAGTGCAGAGGCTGCCAGG - Intergenic
950726210 3:14918667-14918689 CCCTCTGTTCATCTGCTGCCAGG + Intronic
956504216 3:69920583-69920605 CCCTCTCTGCCTCAGCTGCCAGG + Intronic
958657273 3:97018534-97018556 CCCTCTCTGCCTCAGCTGCCAGG - Intronic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
960593380 3:119386821-119386843 CCTTCTCTGTCTCAGCTGCCAGG - Intronic
961429704 3:126872642-126872664 CCTTCCTTGCCTGAGCTGCCAGG + Intronic
962729752 3:138269909-138269931 CCTGCTTTGCAAAAGTTGCCTGG + Intronic
965584560 3:170305791-170305813 CATTTTGTGCATATGCAGCCTGG + Exonic
967693812 3:192507671-192507693 TCTTCTGTTCACAAGCAGCCTGG - Intronic
967722781 3:192832886-192832908 CCTTTTTTGCATAGACTGCCAGG + Intronic
979434578 4:120673499-120673521 AGTTCTGTGCACAGGCTGCCTGG + Intergenic
980448227 4:132939143-132939165 CCCTCTGTGCCTGAGCTGCTAGG + Intergenic
985511474 5:316385-316407 CATCCTGTGGATCAGCTGCCGGG + Intronic
985835554 5:2269569-2269591 CCTCCTGTGCCTAAGCTGGGTGG + Intergenic
986224735 5:5801992-5802014 CCTTCTGTGCTGAACCTTCCTGG + Intergenic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
990439415 5:55829818-55829840 CTTTCTGTGCATTAGGAGCCTGG + Intergenic
992750112 5:79853822-79853844 CCTTCTTGACATGAGCTGCCTGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996386739 5:122916763-122916785 CTTTCTTTACATAAGCTGCTTGG + Intronic
997735961 5:136212723-136212745 ACTTCTGTGGATACGCTACCAGG - Intergenic
999621469 5:153479098-153479120 GCTTCTGTGCATCAGCTCCTAGG - Intergenic
1000132464 5:158313293-158313315 CCTGCTGTGCAAAAGGAGCCGGG + Intergenic
1000996457 5:167964076-167964098 CCTTCTGTGAATAGGCTGGGAGG - Intronic
1005709756 6:28491750-28491772 CCCTCTTTGCCTCAGCTGCCAGG + Intergenic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1007610713 6:43147137-43147159 TCTTCTGTGAATGGGCTGCCTGG + Intronic
1010681865 6:78807766-78807788 CCTCCAGTGCCTATGCTGCCAGG - Intergenic
1011773983 6:90707630-90707652 CCTTCTGTGCACAGGCCTCCAGG - Intergenic
1013596818 6:111668047-111668069 GCTTCTGTGCATAAAAGGCCCGG + Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1018455763 6:163950922-163950944 CTTACTGTGCGTAAGCTGCTGGG + Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1021755002 7:23843210-23843232 AATTCTGTGCACAGGCTGCCTGG - Intergenic
1022120708 7:27305324-27305346 CCTACTGTGTATAAGAAGCCCGG - Intergenic
1023248169 7:38229540-38229562 CCTTCTGTGGTTAAACTGTCAGG - Intronic
1028506871 7:91580490-91580512 GCTTATGTTCATAAGTTGCCAGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1030869441 7:114737166-114737188 ACATGTCTGCATAAGCTGCCAGG + Intergenic
1036723889 8:11201597-11201619 CCTCCTGTGCCTCAGCTGCTGGG + Intergenic
1037613482 8:20495961-20495983 CCTTCTGTGTACCACCTGCCTGG + Intergenic
1038182696 8:25244009-25244031 CCTTCTGTGCCCAAGTGGCCTGG - Intronic
1038204995 8:25457980-25458002 CCTTCAGTGCCTCAGCTGCCTGG - Intronic
1042178356 8:66059871-66059893 CCTTCTGTGCCTACCGTGCCTGG - Intronic
1044752542 8:95430250-95430272 ACTTCTGTGCATATTCTGCTGGG + Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1051378858 9:16434823-16434845 CCTTCTGTGCATAATCCGCATGG + Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1051812916 9:21070532-21070554 TGTGCTGTGCATGAGCTGCCGGG + Intergenic
1052735244 9:32335098-32335120 TCATCTGTGCACAGGCTGCCTGG + Intergenic
1053645243 9:40116311-40116333 TCTTGTGTGCATCAGGTGCCAGG - Intergenic
1053760472 9:41347217-41347239 TCTTGTGTGCATCAGGTGCCAGG + Intergenic
1054539329 9:66259660-66259682 TCTTGTGTGCATCAGGTGCCAGG + Intergenic
1054993282 9:71355028-71355050 ACTTCTTTTCATAAGTTGCCAGG - Intronic
1062092847 9:134687594-134687616 CCTTCTGTGCATCAGATGGTCGG + Intronic
1062104161 9:134743678-134743700 CATTATGTGCAGAAGCAGCCTGG + Intronic
1185543813 X:925873-925895 CCTTTTGTGCATAAGCCAGCTGG + Intergenic
1187543890 X:20228330-20228352 CCTTTAGTGTAAAAGCTGCCTGG - Intronic
1190741370 X:53291033-53291055 CCATCTGTGCCTCTGCTGCCTGG + Intronic
1192181400 X:68917985-68918007 CCTTTTGTGCAAACTCTGCCTGG - Intergenic
1195098935 X:101534796-101534818 CATTTTGTGCATATGCAGCCTGG - Intergenic
1195560207 X:106274620-106274642 CCTTCTGTGCATCAGCTATGAGG + Intergenic
1195561755 X:106291719-106291741 CCTTCTGTGCATCAGCTATGAGG - Intergenic
1199915158 X:152331594-152331616 CCTACTGTGCAATAGCTGGCTGG - Intronic