ID: 1104069095

View in Genome Browser
Species Human (GRCh38)
Location 12:125329194-125329216
Sequence ATGCATGTCCATAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104069092_1104069095 1 Left 1104069092 12:125329170-125329192 CCCTCATGCGAGGATATGGCAAG 0: 1
1: 0
2: 2
3: 33
4: 204
Right 1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 174
1104069093_1104069095 0 Left 1104069093 12:125329171-125329193 CCTCATGCGAGGATATGGCAAGA 0: 1
1: 0
2: 2
3: 14
4: 98
Right 1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 174
1104069091_1104069095 4 Left 1104069091 12:125329167-125329189 CCTCCCTCATGCGAGGATATGGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 174
1104069088_1104069095 13 Left 1104069088 12:125329158-125329180 CCAGCGCTTCCTCCCTCATGCGA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104069095 Original CRISPR ATGCATGTCCATAAGGAAGA AGG Intronic
901944598 1:12691416-12691438 ATCCATGTTTATAAGGATGATGG + Intergenic
909798352 1:79773091-79773113 ATGCATATACATAAGAAAGCTGG - Intergenic
910448221 1:87320283-87320305 ATGCATGTCCTTATGGCAGTAGG + Intergenic
919261770 1:195205423-195205445 ATGCATCCCCACAAGGATGAGGG - Intergenic
922330567 1:224571750-224571772 AAGCAGGTCCAACAGGAAGAGGG + Intronic
922367023 1:224875533-224875555 CTGCCTGTGCATACGGAAGAAGG - Intergenic
923429590 1:233907083-233907105 ATCCATGCCCATAAGAAATATGG - Intronic
1065338833 10:24683771-24683793 GTGCATGTCCAAAGGGAAGGTGG - Intronic
1066464452 10:35640518-35640540 CTCCATGTCGATAAGGAAGGTGG + Exonic
1068249567 10:54420395-54420417 ATAAATGTCCTTAAGCAAGACGG + Intronic
1070424203 10:76269454-76269476 ATGCTGGTCCATATAGAAGATGG + Intronic
1072539375 10:96386564-96386586 ATGCACGTGGACAAGGAAGATGG + Intronic
1073630862 10:105147603-105147625 GTGCATGTCCTGAAAGAAGATGG - Exonic
1075909969 10:126115899-126115921 ATGCATGTATATAATGAAAATGG - Intronic
1078712135 11:13803652-13803674 ATGGTTGTCTATAAGGAAGCAGG + Intergenic
1080065186 11:28002684-28002706 ATGCAAGTCCAAAATGAAGCAGG - Intergenic
1081732982 11:45384653-45384675 ATGGATGGCCATGAGGAATAGGG - Intergenic
1084307775 11:68298096-68298118 ATGTATGTCCATTAGACAGAGGG - Intergenic
1086004046 11:82015172-82015194 AAACATGTCCTTAAGGAATACGG + Intergenic
1087474248 11:98617595-98617617 ATGCATGTCCAAAACCCAGAAGG + Intergenic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1094362776 12:29648176-29648198 ATGCAAGTCCATAAAAAACATGG + Intronic
1095103159 12:38203403-38203425 TTGCATGTCCATGAGGGAGGTGG + Intergenic
1095244458 12:39902892-39902914 ATGCAACTCAATAAGGAATAAGG - Intronic
1104069095 12:125329194-125329216 ATGCATGTCCATAAGGAAGAAGG + Intronic
1105069017 12:133222695-133222717 ATGCAGGGCCAGAAAGAAGAAGG - Intronic
1106639548 13:31569088-31569110 ATGCATGTACACAGGGAAAAGGG + Intergenic
1107101581 13:36598862-36598884 AGGAATGACCATAAGGAAGTAGG + Intergenic
1107220439 13:37973653-37973675 AAGCTTGTCCATAGTGAAGAAGG + Intergenic
1107574380 13:41701911-41701933 ATGCATTTCCATTGTGAAGAAGG + Intronic
1110382628 13:74871714-74871736 ATGTAAGTCAACAAGGAAGATGG - Intergenic
1111423815 13:88052739-88052761 AAGCATGTCAAACAGGAAGAAGG + Intergenic
1112822967 13:103357409-103357431 ATGCATGTCCAACAGGTAGGTGG - Intergenic
1114531571 14:23399859-23399881 AGGAATGCCCATAAGCAAGAGGG + Intronic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1116206602 14:41875220-41875242 ATGCATGTGCAGAAGTAAGTGGG - Intronic
1117881116 14:60314492-60314514 ATGGAGGTAGATAAGGAAGAGGG + Intergenic
1118346427 14:64944482-64944504 TGGCATGTACCTAAGGAAGAGGG - Intronic
1119227671 14:72956464-72956486 CTGCATGTGCACGAGGAAGAAGG + Exonic
1119914847 14:78388502-78388524 ATTCATGTTCATATGGAACAGGG + Intronic
1121445813 14:93978061-93978083 GTGCATGCCCATGAGGCAGAGGG - Intergenic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1126264027 15:46731318-46731340 ATGCATCCCCATATGGCAGAAGG + Intergenic
1127276143 15:57445949-57445971 TTACATTTCCATAATGAAGAGGG - Intronic
1129957733 15:79654822-79654844 ATGCATGGCCACAAGGAGGAGGG - Intergenic
1130678541 15:85975940-85975962 ATCCTTGTCCATAAGGAATAAGG - Intergenic
1131917753 15:97289240-97289262 AGGGATGTCAATAATGAAGAGGG - Intergenic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1135397144 16:22139787-22139809 ATCCCAGTCCATTAGGAAGAGGG + Intronic
1136145860 16:28316287-28316309 ATGGCTGTCCATAAGGTAGGGGG - Intronic
1138350356 16:56343146-56343168 ATGCATGTATAAAAGGAAAATGG + Intronic
1138627139 16:58261374-58261396 AAGCATGGGCATCAGGAAGAGGG + Intronic
1139300707 16:65942967-65942989 ATGCATGTCCCTTAGGATAATGG - Intergenic
1139581364 16:67875809-67875831 AAGCATGTCCATGAGGAGGAGGG - Intronic
1140155261 16:72418376-72418398 CTGCATGGTCATAGGGAAGATGG - Intergenic
1140993178 16:80233882-80233904 ATAAATGGCCAAAAGGAAGATGG - Intergenic
1141684527 16:85562694-85562716 GTCCATGTCCAGGAGGAAGATGG - Intergenic
1142261823 16:89046388-89046410 AGGCATGTCCATGAGGAAATGGG - Intergenic
1147444088 17:40464278-40464300 TGGCAGGTCCATAATGAAGATGG + Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154136587 18:11785327-11785349 ATGGGTGTCCACAAGGCAGATGG + Intronic
1156486922 18:37472239-37472261 AGGCAGGTCCATAAGGACGCTGG - Intronic
1158707897 18:59810238-59810260 AAGATTGTCCAAAAGGAAGATGG + Intergenic
1159049990 18:63412419-63412441 AAAAATGTCCATAAGGAACATGG + Intronic
1166594671 19:44034920-44034942 ATGCCTGGACATAAGGAAGGCGG + Intergenic
926144729 2:10389877-10389899 ATGTATGTCCAACAGAAAGAAGG - Intronic
927184997 2:20475698-20475720 ATACATGTCCTTATGGATGAAGG - Intergenic
928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG + Intergenic
929337676 2:40770233-40770255 ATACATGTACAGAAGGAAAATGG - Intergenic
930007242 2:46907805-46907827 ACTCATGTCCATAAGGAGGTAGG - Exonic
932232447 2:70094052-70094074 ATGCAAGTCCCTATGGAAGAGGG - Intergenic
932301598 2:70671191-70671213 GTGCCTGTGCATTAGGAAGAGGG + Intronic
938513425 2:131976602-131976624 ATGGAAGTCCCAAAGGAAGAGGG + Intergenic
941167096 2:162094285-162094307 ATGAATGCCCTTAGGGAAGAGGG + Intergenic
942309399 2:174641188-174641210 ATCCATGTGCAGAAGGATGAGGG + Intronic
943107055 2:183558649-183558671 TTGAATGTACATAAGAAAGAAGG - Intergenic
945197354 2:207249759-207249781 ATGAATGTCCTTAAGGAAAGAGG + Intergenic
945276713 2:207995147-207995169 ATGAATCTGCAAAAGGAAGATGG - Intronic
945850731 2:215003548-215003570 ATGCAAGTCCTTAAGGACAAGGG - Intronic
945925784 2:215802675-215802697 ATCCATGTGCAAAAGGAAGTTGG + Intergenic
948508930 2:238450113-238450135 ATGCATTTCCACTAAGAAGAGGG - Exonic
1177655707 21:24013880-24013902 ATGCATGTCCACACAGATGATGG - Intergenic
1177994678 21:28082252-28082274 AAGCATGTCTATAAGGACAATGG + Intergenic
1179583169 21:42357791-42357813 AGGGATGGCCATTAGGAAGAAGG - Intergenic
1181410702 22:22716521-22716543 CTGGATGTCAATGAGGAAGAAGG - Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
949412355 3:3779738-3779760 GTGTATTTCCACAAGGAAGAGGG + Intronic
951950040 3:28190013-28190035 AGTCATGTAAATAAGGAAGAAGG - Intergenic
952577290 3:34790534-34790556 AAGCATGTCCATAAATTAGATGG + Intergenic
957408484 3:79804188-79804210 ATTAATGTCCATAAAGAAGATGG + Intergenic
958893801 3:99808346-99808368 TTGCAGGTCCCTAAGGAACAAGG + Intergenic
963410241 3:144918158-144918180 AGGCATGTGCAAAAGGTAGATGG - Intergenic
965238999 3:166169407-166169429 ATGCATGTACAAAAGAAACATGG + Intergenic
966729760 3:183140906-183140928 ATGCAAGTCCATTGGGAAGATGG + Intronic
967666082 3:192173823-192173845 ATGTACATTCATAAGGAAGAAGG - Intronic
968190920 3:196666507-196666529 ATGCGTGGACATGAGGAAGAAGG + Intronic
970326384 4:14929049-14929071 ATGCAGGGCCATAAGGGACATGG + Intergenic
970495109 4:16617196-16617218 ATGCAAGACCATAAAGATGATGG + Intronic
971639433 4:29111837-29111859 GTGCATGTACATGAGAAAGAGGG + Intergenic
971932488 4:33102877-33102899 ATGCAAGTCCAAAAGTAAAATGG - Intergenic
972074126 4:35062216-35062238 ATGCATGTCCATAAGTTAATCGG + Intergenic
972750462 4:41982750-41982772 CTGCATGTGCACGAGGAAGAGGG + Exonic
972922576 4:43962182-43962204 ATGCAGGTGCATGATGAAGATGG + Intergenic
973886452 4:55326857-55326879 TTGCTTGTCCTTCAGGAAGAAGG - Intergenic
974205613 4:58699404-58699426 ATGTATATCCAAATGGAAGAAGG - Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
975869969 4:78769310-78769332 ATGCAGGGCTATAAAGAAGAGGG + Intergenic
976298179 4:83492948-83492970 ATTCATGACCATAAGGAAAGTGG - Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
977523365 4:98113589-98113611 CTGAATGTCCATAGTGAAGAAGG - Intronic
977713941 4:100159780-100159802 AGGCATTTCCATAAGGACCAAGG - Intergenic
979502018 4:121451609-121451631 CTGCATGTCCATGAGGGAGGTGG + Intergenic
980946926 4:139330177-139330199 ATTCATACCTATAAGGAAGAGGG - Intronic
984212050 4:176861795-176861817 ATGCATTTAAATAAAGAAGAAGG + Intergenic
984568910 4:181366164-181366186 ATGAATGTCTGTCAGGAAGACGG - Intergenic
989264465 5:39456969-39456991 AGGGTTGTCCAGAAGGAAGAAGG + Intronic
989435188 5:41404448-41404470 ATGCAAGCACATAAGGAAGAAGG + Intronic
989500031 5:42155761-42155783 CTACATGTGCATAAGAAAGAAGG - Intergenic
992689637 5:79230122-79230144 ATGCCTTTTCAGAAGGAAGATGG - Intronic
993419682 5:87685290-87685312 ATGGTTGTCTATGAGGAAGAGGG - Intergenic
993476062 5:88366079-88366101 ATGCATGTCGTTAGGGAAGCAGG + Intergenic
996631298 5:125636139-125636161 ATGCATATGCATAAGGTAGGTGG + Intergenic
997941499 5:138161861-138161883 ATACCTGTCCAAAAGGAATAAGG + Exonic
998293694 5:140943610-140943632 ATTCATCTGCATAAGGAAGCTGG + Intronic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001054263 5:168436222-168436244 TGGCAGGTCCAGAAGGAAGATGG - Intronic
1003613237 6:7631730-7631752 TTGCATTTCCATCGGGAAGATGG + Intergenic
1004453260 6:15767234-15767256 ATACAGTTACATAAGGAAGAAGG + Intergenic
1004643706 6:17539614-17539636 CTGCATGGACATAAGGAACATGG - Intronic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1007189805 6:40003779-40003801 AACCATGCCCAGAAGGAAGATGG - Intergenic
1008334302 6:50281820-50281842 AAGGAAGTCCACAAGGAAGAGGG + Intergenic
1009315706 6:62217142-62217164 ATGCATGTGCTTAATGCAGAAGG + Intronic
1011755669 6:90496249-90496271 ATGTATCTCCATGAGTAAGAGGG + Intergenic
1012482554 6:99683622-99683644 TTGGCTGTCCTTAAGGAAGATGG + Intergenic
1013794279 6:113868218-113868240 ATGCCTGTCCATATTGATGAGGG - Intergenic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1018043255 6:159943654-159943676 ATTTATGTCCCTAATGAAGAGGG + Intergenic
1018204998 6:161428921-161428943 ATGCCTGGCCATCAGGAAGAAGG - Intronic
1021942477 7:25691485-25691507 GCAGATGTCCATAAGGAAGATGG + Intergenic
1022288297 7:28976247-28976269 TGGCATGTACAGAAGGAAGATGG + Intergenic
1022479561 7:30734034-30734056 AAGCATGACCACAAGGAAGGAGG - Intronic
1024731681 7:52260312-52260334 GTGCATGTCCTGAAAGAAGAGGG + Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1026845964 7:73699419-73699441 CTGCCTGTCCACAAGGGAGAGGG + Exonic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1029859916 7:103559539-103559561 ATGCAAGTGTATAAGGAAGAGGG - Intronic
1030936132 7:115586404-115586426 ATCCATGTTCCTGAGGAAGAAGG + Intergenic
1032830535 7:135620582-135620604 ATGCCTGTGAATAAGGAAAATGG - Intronic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1034053975 7:148015143-148015165 ATACCTGTCCATAAGCATGAAGG + Intronic
1034185695 7:149174932-149174954 ATACATATCTATAAGGAAAAAGG - Intronic
1035866265 8:3085799-3085821 TTGCATATCCATCAGAAAGATGG + Intronic
1037028315 8:14068028-14068050 AAGCATCTCCATAGGGAAGGAGG + Intergenic
1037069351 8:14624487-14624509 ATGCATGTCCATAAGAGCAAAGG + Intronic
1038093397 8:24280321-24280343 ATGCATCTGCATAACTAAGAAGG - Intergenic
1039064653 8:33598252-33598274 ATGCATGAGCTTATGGAAGAAGG + Intronic
1042012372 8:64261681-64261703 ATGCATTTTTATAAGCAAGAAGG + Intergenic
1043467079 8:80520194-80520216 ATTCATGTCAAAAAGGAAGAGGG - Exonic
1044051064 8:87504902-87504924 ATGTAAGTCCATATGGAAAAAGG + Intronic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048323187 8:133417866-133417888 AGGCATCTCCAGAAGGAAGGGGG - Intergenic
1049268063 8:141680101-141680123 ATGCATGTGGATGAGGATGATGG + Intergenic
1051514813 9:17917614-17917636 ATCTATGTCCATGAGGAATAAGG + Intergenic
1052237587 9:26230697-26230719 AAGCATATCCTTAAGAAAGAGGG - Intergenic
1053330120 9:37197961-37197983 ATGACTGTCTATAAGGAAAAAGG + Intronic
1055747857 9:79470550-79470572 ATCCATCTCTCTAAGGAAGAGGG + Intergenic
1056922166 9:90801092-90801114 AGGAATGTCCAAAAGGAAAAGGG + Intergenic
1058399538 9:104598631-104598653 CTTCATGTACATGAGGAAGATGG + Exonic
1059490893 9:114666590-114666612 GGGCATCTCCATGAGGAAGAGGG - Intergenic
1059887601 9:118763959-118763981 CTGCATGTCCATGAGGGAGGTGG + Intergenic
1060774282 9:126359334-126359356 GTGTATGTTCATAAGGAATATGG + Intronic
1186996797 X:15132174-15132196 ATGCAGGTGCTTAAGGAAGGAGG - Intergenic
1187476189 X:19613123-19613145 GTGGATGTCCCCAAGGAAGACGG + Intronic
1187711447 X:22058507-22058529 ATGCCTGTAAATAAGGAAGCTGG + Intronic
1188291602 X:28395774-28395796 ATGCAGGTCCTTAATGAGGATGG + Intergenic
1188826135 X:34837782-34837804 ATGCATGTCCTTACAGATGAAGG + Intergenic
1189000460 X:36938540-36938562 TGGCATGTCCATAAGGAGAAAGG + Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1193935657 X:87616920-87616942 TTGCATAACCATAAGGAAAAGGG - Intronic
1194244294 X:91492841-91492863 ATGCATGTCCAAAACCAAGCAGG + Intergenic
1194327574 X:92539644-92539666 ATGAATGTCCATAAGCAATCAGG - Intronic
1200563274 Y:4734139-4734161 ATGCATGTCCAAAACCAAGCAGG + Intergenic