ID: 1104071535

View in Genome Browser
Species Human (GRCh38)
Location 12:125350084-125350106
Sequence CAGTGTCCTCTGGAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104071530_1104071535 -5 Left 1104071530 12:125350066-125350088 CCAGCTGACAAGGCTGGCCAGTG 0: 1
1: 0
2: 2
3: 12
4: 168
Right 1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 421
1104071529_1104071535 -4 Left 1104071529 12:125350065-125350087 CCCAGCTGACAAGGCTGGCCAGT 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 421
1104071526_1104071535 24 Left 1104071526 12:125350037-125350059 CCACGATGGAGCTCTTCTTCACG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104071535 Original CRISPR CAGTGTCCTCTGGAGGAGGA AGG Exonic
900618920 1:3578097-3578119 CCGTGTCCTCTGGGAGGGGAGGG - Intronic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903928967 1:26851266-26851288 CAGCGCCCTCAGGAGGAGGCAGG + Intronic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904893595 1:33797725-33797747 TAGTGTCTTCTGCTGGAGGAAGG + Intronic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
906279687 1:44544600-44544622 AACTGTCCTCCGGAGAAGGAGGG + Intronic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
907507980 1:54935732-54935754 CAGTGTCCTCAGGCTGAGGTGGG + Intergenic
907947725 1:59151139-59151161 CAGTGTCCTCTGGGGAGGAAGGG + Intergenic
908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG + Intergenic
910226315 1:84939741-84939763 CACTGCCCTCTGGAAGAAGAAGG + Intronic
911074757 1:93862274-93862296 AAGTTTCCTCTGGAGGAGAAGGG + Intergenic
913191959 1:116420428-116420450 CCTTGTCATCTGGAGGAGGAAGG - Intergenic
914379357 1:147102670-147102692 CTGCGTCCTCAGGAGGAGGGAGG - Intergenic
914741957 1:150472716-150472738 CACTGTGCTCTCCAGGAGGAGGG - Exonic
915123432 1:153647257-153647279 CAGTCTCCTCTGGGGTAGGAGGG - Intergenic
915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG + Exonic
915558188 1:156671372-156671394 CTGAGGTCTCTGGAGGAGGAGGG - Exonic
916674541 1:167054576-167054598 CAGTGTCCTCTGCAGCTGGTGGG - Intronic
917276124 1:173333616-173333638 CTGTGTCCTCAGGAGTTGGAGGG - Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920954262 1:210603128-210603150 CAGTTTCTTCTGGAGTAAGACGG + Intronic
921526182 1:216221338-216221360 CAGTGCCCTCTAGAGGAGTTTGG + Intronic
922724899 1:227918215-227918237 GAGGGCCCTCGGGAGGAGGAGGG - Intergenic
922913702 1:229238871-229238893 CAGGGCGCTCGGGAGGAGGAAGG - Intergenic
923277568 1:232411378-232411400 CACTGTCCTCTGCAGGGAGATGG + Intronic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1063162138 10:3426185-3426207 CAGTGTCCTATGAACCAGGATGG - Intergenic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1063539126 10:6914349-6914371 CTGTGTCCACTGGAGGAGCTCGG - Intergenic
1063899474 10:10717722-10717744 CAGGGTCCTTTGGAGGAAGAGGG + Intergenic
1064177933 10:13091395-13091417 CAGTGTCCTCATGTGGTGGAAGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064371496 10:14755653-14755675 AGGTGTTCTCTGGAGAAGGATGG - Intronic
1065478233 10:26164375-26164397 AAATCTCCTCTGAAGGAGGAGGG + Intronic
1066364467 10:34763434-34763456 CTGTGTCCTCTGGGGGAAGGTGG + Intronic
1067042035 10:42959982-42960004 CAGTGGCCTCTGCAGGGGCAGGG + Intergenic
1067711611 10:48655432-48655454 CAGTGACCTCAGGGGGAGAAGGG + Intronic
1067716690 10:48695873-48695895 CAGTGTCCTGTGGAAGGGGCTGG - Intronic
1067925246 10:50502142-50502164 GAGAGGCCTCTGGGGGAGGAGGG - Intronic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1069496093 10:68904499-68904521 GAGCATCCACTGGAGGAGGAAGG + Intronic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1071336398 10:84604012-84604034 TGGTGTCCACTGGAGGAAGACGG + Intergenic
1072449716 10:95530275-95530297 CAGGGTCCTCTGGGAGAGGTAGG - Intronic
1073180673 10:101581137-101581159 CAGTGTCCTGGGGTGGAGGCAGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1073434819 10:103510062-103510084 AAGTCTCCTCTAGAAGAGGAAGG - Intronic
1074360369 10:112820694-112820716 TAGTGTCCTGTTGTGGAGGAGGG + Intergenic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1076482819 10:130796048-130796070 CAGAGGCCGCTGGAGGAGGGTGG + Intergenic
1077162332 11:1119500-1119522 CAGTGTCCTTTTGAGGCTGAAGG + Intergenic
1077367204 11:2166052-2166074 CAATGTCCTGTGGAGCAGGGAGG + Exonic
1077748704 11:4938711-4938733 CAGTTTACTCTGGATTAGGAGGG + Intronic
1078131091 11:8614750-8614772 CAGAGTCCGCTGGTGGGGGATGG + Exonic
1078522824 11:12077030-12077052 CTGTGTTCTTTTGAGGAGGAGGG + Intergenic
1078552008 11:12287691-12287713 CAGTGTCCTGGGGAAGAGCAGGG + Intronic
1078727731 11:13946606-13946628 CAATGTCCTCTGGAGGAGTGAGG + Intergenic
1079095951 11:17510238-17510260 CACTCCCCTCTTGAGGAGGAGGG - Intronic
1079321132 11:19452452-19452474 CAGTGGGCTATGGAAGAGGATGG - Intronic
1080109116 11:28545918-28545940 CTGTGTCCTTTGGATGAGCATGG + Intergenic
1080820877 11:35805298-35805320 CAGTGACCTATAGAAGAGGATGG + Intronic
1081527185 11:43935107-43935129 TAGAATCCTCTGGAGGATGAGGG - Intronic
1081714524 11:45239440-45239462 CCCTGGCCTCTGGAGGAAGAGGG - Intergenic
1082844032 11:57712722-57712744 CAGTTTCCTCACGAGTAGGAAGG - Exonic
1083792840 11:64996961-64996983 CAGTGCCCTCTGGAGGCCTAAGG + Exonic
1084186428 11:67474861-67474883 CTGTGACCTCTGGAGGGGCAAGG + Intergenic
1084262720 11:67989880-67989902 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1087876237 11:103361296-103361318 AAGTGTCCTCACGTGGAGGAAGG - Intronic
1088691719 11:112334229-112334251 CAGTGGGCTTTGGAAGAGGAAGG + Intergenic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1090283384 11:125477781-125477803 CAGTGTCCCCTGGAGGCAGAAGG - Intronic
1090465832 11:126932235-126932257 GTGTCTCCTCTGGAAGAGGAGGG + Intronic
1090852228 11:130580548-130580570 CATTGTTTTCTGGAAGAGGAAGG + Intergenic
1090961238 11:131558755-131558777 TAGTGTCAGCTGGAGGAGAAGGG + Intronic
1091240543 11:134049328-134049350 CAGTGCCGTCTGGGGGAAGAAGG + Intergenic
1091834798 12:3577949-3577971 TGGTTACCTCTGGAGGAGGATGG - Intronic
1091987903 12:4927999-4928021 AAGTGCCCTCTGGTGAAGGAAGG + Intronic
1092653872 12:10664341-10664363 CAGTGGTCTCTGTAGGAGGATGG - Intronic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096283481 12:50277334-50277356 CAGTGTCCACCGGAGTAGCAAGG - Intronic
1096476909 12:51914020-51914042 CACTGTCCTCTGCACCAGGAAGG - Exonic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1101748566 12:107563618-107563640 CAGAGTCCTATGGAGGAAGAGGG + Intronic
1102413327 12:112739157-112739179 GGGTGTCCTCTTGAGGAGGCAGG - Intronic
1103343223 12:120232378-120232400 CTGGGACCTCTGGAGGAGGGAGG - Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104805719 12:131588065-131588087 CTGTGTCCTCCCGAGGAGGAAGG - Intergenic
1105204564 13:18209829-18209851 CAGTGCCCCATGGAGGAGGGAGG - Intergenic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1105899299 13:24742175-24742197 CAGGGTTCTTTGGAGGAAGAAGG + Intergenic
1106094233 13:26628769-26628791 CAGTGTCCACTGGTGCAGAATGG + Intronic
1106101070 13:26695508-26695530 CACTGCCTGCTGGAGGAGGAGGG - Intergenic
1106884445 13:34168921-34168943 CAATGTCCTCACAAGGAGGAAGG + Intergenic
1107145778 13:37059440-37059462 CAGAGCCCGCTGGAGGAAGACGG - Intronic
1107448411 13:40487948-40487970 TGGTGGCCTCTGGGGGAGGAGGG + Intergenic
1107594038 13:41942888-41942910 AAGTGGCCTCTGGAGGCTGAGGG + Intronic
1109186066 13:59269970-59269992 ACGTGTCCTTTGGAGGAAGAAGG + Intergenic
1109653086 13:65353910-65353932 CAGTGTCTACTGGAGTAGGCTGG - Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110456066 13:75691779-75691801 CAGTATCCTAATGAGGAGGAGGG - Intronic
1111430842 13:88146628-88146650 CAGTGACCTCTGGAGGGGCAAGG + Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112399903 13:99067512-99067534 CAGTGACCTTTGGGAGAGGAGGG - Intronic
1112751666 13:102589614-102589636 TAGTGTCCTCTGGAGGTAAATGG + Intergenic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113428643 13:110230590-110230612 CAGTGGCTTCTGCAGGAGGCTGG - Intronic
1114046446 14:18880524-18880546 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1114117766 14:19638926-19638948 CAGGGGCCTCTGGAGGGGGCGGG - Intergenic
1114181650 14:20373139-20373161 ATGTGTCATCTGGAGGAGAAAGG + Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1117106777 14:52405490-52405512 CAGTGTCCTCTGGAGAACAGAGG - Intergenic
1118149843 14:63178088-63178110 AGGTGTCTTCTGGAGGAGTAAGG - Intergenic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119731768 14:76955848-76955870 CAGGGACCTCTGCAGGTGGATGG + Intergenic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1121030798 14:90657131-90657153 CAGAGTCCTCTGCAGGAGCGGGG + Intronic
1121219038 14:92272048-92272070 CCTCTTCCTCTGGAGGAGGAAGG - Intergenic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1122817068 14:104319145-104319167 CAGAGGGCTCTGGGGGAGGAAGG - Intergenic
1123547525 15:21352153-21352175 CACTGTCCTCTGGAACAGGCTGG - Intergenic
1124371014 15:29104662-29104684 CAGTGCCCACTGGAGGCAGAGGG - Intronic
1124864739 15:33478088-33478110 CAGTGTCCACTTGAGGGGGTTGG + Intronic
1127504388 15:59583671-59583693 GAGTGTCCTCTGCAGGAACATGG - Intergenic
1127535910 15:59889735-59889757 TTGTGTCCTCTCGAGGTGGAAGG - Intergenic
1128261506 15:66236192-66236214 CTGTGTGTTCTGGAGGAGGGAGG + Intronic
1129410716 15:75348868-75348890 CAGAGTCCTGTTGGGGAGGAAGG - Exonic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1131637632 15:94253925-94253947 CAGTGTGCTCTGGAGCATCAAGG - Intronic
1202955855 15_KI270727v1_random:79383-79405 CACTGTCCTCTGGAACAGGCTGG - Intergenic
1132700707 16:1220920-1220942 CAGTGTCCTCTGGAGAAACCAGG + Exonic
1132853874 16:2036263-2036285 GAGTGGCCTCTGGAGGCGGGAGG + Intronic
1133033550 16:3022721-3022743 CAGTGTCCTCTGTTGAGGGAAGG + Exonic
1133780676 16:8936629-8936651 CAGTGGCCTCTGCTGGGGGATGG + Intronic
1133813331 16:9177915-9177937 CTGTGTCCTCTTGAGGTGGAAGG + Intergenic
1135382964 16:22008925-22008947 CAGCTTCCTCTGGTGGTGGAGGG - Intronic
1135422433 16:22314134-22314156 CCCTGGCCCCTGGAGGAGGAGGG + Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135695857 16:24585702-24585724 CAGTGCACTCTGGAGAAGGAAGG + Intergenic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136041537 16:27583390-27583412 CAGTGACTTCTGGGGGTGGAGGG - Intronic
1136293910 16:29291174-29291196 AAGTCACCCCTGGAGGAGGAGGG - Intergenic
1137441572 16:48502980-48503002 CATTGTCTTCTGTGGGAGGATGG - Intergenic
1138313936 16:56052252-56052274 CACTGTTCTCAGGATGAGGAAGG + Intergenic
1138594083 16:58020256-58020278 CAGAGGGCCCTGGAGGAGGAAGG - Exonic
1140642873 16:76997502-76997524 TAGTGTCCTCTGAAGCAAGAAGG - Intergenic
1141813401 16:86391973-86391995 CAGTGTCTGCTGGAGGAGGCAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142099813 16:88265220-88265242 AAGTCACCCCTGGAGGAGGAGGG - Intergenic
1142212227 16:88813607-88813629 CGCTGGCCTCTGGAGGAGGCCGG + Intergenic
1142523262 17:519666-519688 GAGAAGCCTCTGGAGGAGGATGG - Intronic
1142614046 17:1124868-1124890 CTGGGTCCTCTGGAGGAGACAGG + Intronic
1142650150 17:1344156-1344178 CACTAGCCTCTGGAGGAAGAGGG + Intergenic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1143561802 17:7700908-7700930 CAGGGGTCTTTGGAGGAGGAAGG + Intronic
1144932899 17:18874586-18874608 GGGTGTGCTCTGAAGGAGGAAGG + Intronic
1145203121 17:20964744-20964766 CCATGTCCTCTGCAGTAGGATGG - Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147498370 17:40938869-40938891 CAGTGTTCTGTGGATGTGGACGG + Intergenic
1147585537 17:41652325-41652347 CTGTGTCCTGTGGTTGAGGATGG - Intergenic
1147792222 17:43021117-43021139 GGGGGTCCTCTGCAGGAGGAAGG + Intronic
1147843566 17:43389347-43389369 CGGGGTGCTCTGGAGGAAGATGG + Intergenic
1148809861 17:50283568-50283590 CACTGTGCTCTGGCGGGGGAAGG - Intergenic
1148823616 17:50376157-50376179 CAGTGTCACTTGGAGGAGAAGGG + Exonic
1148835734 17:50464848-50464870 CAGTGTCCTGGGGAGAAGGAAGG - Exonic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149681794 17:58512715-58512737 CCCTGGTCTCTGGAGGAGGAGGG - Intronic
1149707466 17:58707880-58707902 CTGTGTCCTCATGGGGAGGAAGG + Intronic
1149820858 17:59775723-59775745 CAGTGTCCTCAAGATGAGCAAGG + Intronic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1150415370 17:64983882-64983904 CAGTGGCCTCACGTGGAGGAAGG - Intergenic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151476356 17:74346233-74346255 CAGTGGCCTTGGCAGGAGGACGG + Intronic
1152261327 17:79268834-79268856 CAATGTCCTCTGTGGGAGGAAGG - Intronic
1152365193 17:79851524-79851546 CAGTATCCTCTGGATGTTGATGG + Intergenic
1152610606 17:81313481-81313503 CTGTGGCCTCTGCAGGAGGGAGG - Exonic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1153607289 18:6847121-6847143 AACTGTCCTCTGGATAAGGAGGG + Intronic
1153823129 18:8849470-8849492 CAGAGTCCAGTGGAGGAGAAAGG + Intergenic
1154060344 18:11054675-11054697 CAGTGTTCACTGGAGAATGAGGG - Intronic
1155261258 18:24044634-24044656 CAGTGGCCTTTGGAGGCTGACGG - Intronic
1155383241 18:25247741-25247763 CAGAGCCCTTTGGAGTAGGAGGG + Intronic
1155989599 18:32266371-32266393 CAGTGCCCTCTTGAATAGGAAGG - Intronic
1157438750 18:47693512-47693534 CAGTGTACTTTGGAAGAGGTGGG + Intergenic
1157867731 18:51200160-51200182 CAGTAAGCTCTGGAGGAGGTGGG + Intronic
1158011217 18:52730175-52730197 CAGTGTTCTCTGGTGTGGGAGGG - Intronic
1158738637 18:60113404-60113426 CTGTATCCTCTGGATGTGGAAGG + Intergenic
1160511874 18:79457429-79457451 CAGTCCCCACTGCAGGAGGAGGG + Intronic
1160528942 18:79552520-79552542 CAGAGTCCTCTGGGTGAGGGTGG - Intergenic
1160711901 19:555976-555998 CTGTGACCTCTGGAGGAGGCTGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161075227 19:2282098-2282120 GCGTGCCCTCTGGGGGAGGAGGG + Exonic
1161143873 19:2665351-2665373 CAGTGTCCCCTGGGGGGGGGGGG + Intronic
1161327771 19:3671685-3671707 GAGTGTCCTGTGGAGGAGAGGGG + Intronic
1161644686 19:5445804-5445826 CAGAGGCCACTGGAGGAGGCTGG - Intergenic
1161854048 19:6753635-6753657 CAGGGTCCTGCGGAGGGGGAGGG + Exonic
1162388601 19:10375971-10375993 CAATTTCCTGTGCAGGAGGAGGG + Intronic
1164216648 19:23156440-23156462 CAGTGACCACTGGTAGAGGAAGG + Intergenic
1165272433 19:34722610-34722632 CACTGTCTTCTGGAGGGGAATGG + Intergenic
1165520730 19:36311925-36311947 CTGTGTCCCCTAGAGTAGGAGGG + Intergenic
1165623342 19:37266660-37266682 CTGTGTCCCCTAGAGTAGGAGGG - Intergenic
1166141823 19:40809332-40809354 CAGTTACCCCTGGAGCAGGAAGG - Intronic
1166665951 19:44680575-44680597 TAGTGGCCTGTGGAGGTGGATGG - Intronic
1167466628 19:49653708-49653730 GAGTGTCCCCTGGGGGAGGGTGG + Intronic
1167885394 19:52495799-52495821 CACTGTCCTCTGGCTGAAGAGGG - Intronic
1167890960 19:52538977-52538999 CACTGTCCTCTGGCTGAAGAGGG - Intronic
1167912999 19:52719407-52719429 CACTGTCCTCTGGCTGAAGAGGG + Intronic
1167920987 19:52783105-52783127 CACTGTCCTCTGGCTGAAGAGGG + Intronic
1167944872 19:52979948-52979970 CACTGTCCTCTGGCTGAAGAGGG + Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925052558 2:828604-828626 AAGGGTCCTCTGTAGAAGGATGG - Intergenic
925356394 2:3244618-3244640 CTGTGTCCTCTAGTGGTGGAAGG - Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925617428 2:5757107-5757129 CTCTATCCTTTGGAGGAGGAAGG - Intergenic
925955722 2:8961969-8961991 CAGTCCCCTCTGGAGGAGAGGGG - Intronic
927707644 2:25306642-25306664 CATTGTCTTCTGGAGGTGCAGGG + Intronic
927714440 2:25342567-25342589 CAGTGGGCTCTGGCGGAGGTCGG - Exonic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
929436791 2:41934800-41934822 GAGTGTCCTCTGGGGGCCGAGGG - Intergenic
929671258 2:43877736-43877758 CAGTGGGCTCATGAGGAGGATGG - Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
932848034 2:75154937-75154959 CAGACTCATCTGGAGGAGAAAGG - Intronic
934688915 2:96342442-96342464 CCGTGTCCTCTGGAGAATGGGGG + Intronic
934727246 2:96631328-96631350 CCCAGTCCTCTGGTGGAGGAGGG + Exonic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
935826938 2:106961728-106961750 CAGGGAGCTCTGGAGCAGGATGG - Intergenic
936012801 2:108935994-108936016 CAGTGCCCACTGCAGGAAGAAGG + Intronic
936902152 2:117493571-117493593 CAGTGTCCTGTGGTGAAGGACGG - Intergenic
937272017 2:120659053-120659075 CTTTGTCCTTTGGAGAAGGAAGG - Intergenic
938213009 2:129484395-129484417 CAGTGACCTCCTGAGGAGCAGGG - Intergenic
938376198 2:130808317-130808339 GAGTGCCCTGGGGAGGAGGATGG + Intergenic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
940240074 2:151553178-151553200 CATCGTCCTCTGGTGGAGAAGGG - Intronic
941807263 2:169722057-169722079 CTGTGTCCTCTCAAGGTGGAAGG - Intronic
944008911 2:194947420-194947442 CAGTGTCCTCTGGCATAGAATGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945044617 2:205770865-205770887 CTGTGTCCCCTGGGGAAGGATGG - Intronic
946007508 2:216538273-216538295 AACTGGGCTCTGGAGGAGGAAGG - Intronic
946018075 2:216620175-216620197 CAGTGGCCTCAGGAGGGTGAGGG + Intergenic
946171457 2:217898374-217898396 CAGACTGCTCTGGAAGAGGAAGG + Intronic
946290223 2:218738835-218738857 CAGTTTCCTCAGGAGGATGCTGG + Exonic
946332194 2:219016729-219016751 CACTGGTCTCTGGAGGAGAATGG - Intronic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947740069 2:232480929-232480951 CACGGTCCACTGGAAGAGGAAGG - Intronic
947869986 2:233429674-233429696 GGGTGTCCTCTGGAGGGAGAGGG + Intronic
948642058 2:239381827-239381849 AAATGTCCCCTGGGGGAGGAGGG + Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1168834459 20:868830-868852 CAGAGTGCTCTGGGAGAGGAAGG + Intergenic
1168850740 20:975210-975232 CAGTGTCCCCTGGAGCACCAGGG - Intronic
1170706647 20:18749748-18749770 CAGTGTCCTCTGTGGCAGGGTGG - Intronic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1174113156 20:48210200-48210222 CCGTGTCCTCGAAAGGAGGAGGG - Intergenic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1175528849 20:59660080-59660102 CAGTGTCCTCTGAAAGTGGGGGG - Intronic
1175967286 20:62665976-62665998 CAGAGGCCCCTGGGGGAGGAGGG + Intronic
1176037356 20:63046197-63046219 CCGTGTCCTCTGGAGGGGAGCGG - Intergenic
1176101782 20:63367736-63367758 GAGTGTCCTCTGGATTGGGAGGG - Intronic
1176713413 21:10328259-10328281 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
1177409910 21:20716915-20716937 CAGTTGCCTCTGCAGAAGGAAGG + Intergenic
1178591046 21:33910412-33910434 CACTGTCCTCTGGATGATGCAGG - Intronic
1179522009 21:41951918-41951940 CTGTGTCCTTTGTAGGAGGCAGG - Intronic
1180464982 22:15603160-15603182 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1180581561 22:16844172-16844194 CAGTGACCTCTGTAGGCAGAGGG + Intergenic
1180829794 22:18898838-18898860 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
1181035875 22:20169535-20169557 CAGTGACCACAGGACGAGGAGGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1181796103 22:25312250-25312272 CAAAGTCCTCTGGGAGAGGAGGG + Intergenic
1181836647 22:25615860-25615882 CAAAGTCCTCTGGGAGAGGAGGG + Intronic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1183346304 22:37310192-37310214 CCGAGTGCTCTGGAGGAGGATGG - Intronic
1183645349 22:39123275-39123297 AGGTCTCCTCTGGAGAAGGAGGG - Intronic
1184403534 22:44287255-44287277 CAGTGGCCTCTGTAGGAAGATGG + Intronic
1184695057 22:46134318-46134340 CATTGCCCTCTGCAGGAGGAGGG - Intergenic
1184913262 22:47550098-47550120 CACTGGCCCCTGGGGGAGGAGGG + Intergenic
1185049749 22:48547798-48547820 CAGAGTCCTCTGGAGAGAGACGG - Intronic
1185185448 22:49396572-49396594 CAGTGCCCTCTGCAGGGGGCAGG + Intergenic
1203279885 22_KI270734v1_random:124111-124133 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
950097572 3:10338868-10338890 CAGTGACCTCAGGAGGAATAAGG - Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
950662554 3:14475597-14475619 CAGTGTTCTCTGGAAGCGGCAGG + Intronic
950671765 3:14531628-14531650 CAGTGGCCTTGGGAGGAGGTAGG + Intronic
950681447 3:14588076-14588098 CAGTCTCCTGAGGAGGAGGTTGG - Intergenic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953439973 3:42908699-42908721 CAGTGTCTTCAGGGGTAGGAGGG - Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
954847665 3:53574051-53574073 CACTGTGCTCTGGAGGAGGAAGG + Intronic
955525001 3:59810712-59810734 CAGTGTACTTTGGAGGGGGAGGG - Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955862179 3:63343406-63343428 CAGTGTTCTCTGTAAGAGGGTGG + Intronic
956725470 3:72153082-72153104 CACTGAACTCTGGAGGAGGCTGG - Intergenic
957078158 3:75617822-75617844 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
957230820 3:77511644-77511666 CAGTGGTCACTGGAGGATGAAGG + Intronic
959594230 3:108111632-108111654 CAGTGTCCTCACGTGGTGGAAGG + Intergenic
960008384 3:112805681-112805703 CTGTGTCCTCTCCAGGAGAAGGG - Intronic
960435607 3:117622789-117622811 CATCTTCCTCTGGAAGAGGAGGG + Intergenic
960629053 3:119710377-119710399 CTGTGTCCTCACGTGGAGGAAGG + Intronic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
962312169 3:134334381-134334403 CTGTGTTCTCTGGAGTAGGGGGG + Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962988749 3:140559710-140559732 CAGTGGCTTTTGGAGGGGGAGGG - Intronic
963914477 3:150845377-150845399 GAGTGTCCTCTGGGAGAGGGAGG + Intergenic
963918651 3:150884818-150884840 CAGTGGGCTCCAGAGGAGGAAGG - Intronic
966143649 3:176785978-176786000 CCCAGTCCTCTGAAGGAGGAAGG + Intergenic
966430502 3:179827272-179827294 GAGTGTCCTCAGGAAGAGGTAGG - Intronic
967013111 3:185457479-185457501 CTGTGTCCTCACGAGGTGGAAGG + Intronic
967097588 3:186189910-186189932 GGGTGGCCTATGGAGGAGGAAGG - Intronic
967955053 3:194871687-194871709 CAGTGTCCTCAGCAGGAGCCCGG - Intergenic
968275812 3:197439560-197439582 CAGTGTCCACTGGAGCAAGAAGG - Intergenic
968641148 4:1715708-1715730 CAGGGCCCTCTGCAGGAGCAGGG - Intergenic
969021233 4:4141795-4141817 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
969646288 4:8431410-8431432 CAGTGTCCTCAGGCCCAGGAGGG - Intronic
969732634 4:8965621-8965643 GAGTGTTCTCTGGAGGTGGCTGG + Intergenic
969792216 4:9499704-9499726 GAGTGTTCTCTGGAGGTGGCTGG + Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
976019141 4:80598733-80598755 CAATGTCACCTAGAGGAGGAAGG - Intronic
976126337 4:81837311-81837333 CACTGTGCTCTGGAGGGGGCTGG + Intronic
976217554 4:82729324-82729346 CAAGGACTTCTGGAGGAGGAGGG + Intronic
977765314 4:100790788-100790810 CATTGTCCTTTGAGGGAGGAAGG - Intronic
978456013 4:108892802-108892824 CAGTCTCCTCTGGATTAGGTAGG - Intronic
979217508 4:118183129-118183151 TAGTGTCGTCTGGTGGAGAATGG - Intronic
983859760 4:172691075-172691097 CAGTGAGCACTGGAGGAGGCAGG + Intronic
984313184 4:178090820-178090842 CTCTGTCCTCTGGGGGAGGGCGG + Intergenic
985658872 5:1145755-1145777 CTCTGTCCTCTGCAGAAGGAAGG + Intergenic
987195162 5:15518632-15518654 CAAAGTCCTCTACAGGAGGATGG - Intronic
987330351 5:16851602-16851624 CACTGTCCTTTTGAGGATGAAGG + Intronic
988483094 5:31645930-31645952 CAGTGTACTCAGTAGGGGGAAGG + Intronic
988532095 5:32036908-32036930 AAGTGTCCTCAGGTGTAGGATGG + Intronic
988706056 5:33726977-33726999 GAGTTTCCTCTGGAGCTGGAAGG - Intronic
989484059 5:41967772-41967794 CAATGTGCTCTGGAAGAGGCAGG + Intergenic
990006029 5:50945333-50945355 CAGTGTCCTGAGGATGAGCAGGG - Intergenic
990314097 5:54567850-54567872 CAGTGGGCTCTGAAGGTGGAGGG - Intergenic
990315160 5:54576704-54576726 CTGTGTCCTCTTCAGGAGGCTGG - Intergenic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
992477561 5:77118444-77118466 CAGAGTACTCTGGGTGAGGAGGG + Intergenic
992845857 5:80746602-80746624 CATCATCCTCGGGAGGAGGACGG + Intronic
992910804 5:81394186-81394208 CAGTGCCCTCTGGAGCTGGGCGG - Intergenic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
994190073 5:96859471-96859493 CATTCTCCTCTGTAGGTGGATGG + Intronic
995126492 5:108581877-108581899 CAGTGTCCTCATGTGGTGGAAGG + Intergenic
995209796 5:109524684-109524706 CTGTTTTCTCTGCAGGAGGATGG - Intergenic
998569299 5:143243185-143243207 CAGTGTCCTCTGGGGCTGGAAGG - Intergenic
999457108 5:151726115-151726137 AAGTTTCCTCTCCAGGAGGAAGG - Intergenic
999808339 5:155104826-155104848 AAATGTGCTCTGGGGGAGGAAGG + Intergenic
1001417419 5:171555708-171555730 GAGTGTCCCCTGGTGGAGGTCGG - Intergenic
1001482762 5:172099943-172099965 CAGCGTCCTTAGGAGGAGGAAGG + Intronic
1001535548 5:172495443-172495465 CTCTGCCCTTTGGAGGAGGAAGG + Intergenic
1001868154 5:175123802-175123824 CAGTGTCTTCTGAAGGAAGGAGG + Intergenic
1002594695 5:180314211-180314233 CATTTTCCTCTTGAGGATGAGGG + Intronic
1002598294 5:180338556-180338578 CAGAGTCCCCCGGACGAGGAAGG - Exonic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1004760166 6:18657003-18657025 GAATGTCCCCTGGTGGAGGAGGG - Intergenic
1005592143 6:27339638-27339660 CAGAAACCTCTGGAGGATGAAGG - Intergenic
1005963919 6:30713044-30713066 CACTGTCCTCTCCAGGAGGTTGG + Exonic
1006516628 6:34549202-34549224 CTGGGGCCTCTGGAGCAGGAGGG - Intronic
1006756317 6:36418796-36418818 CAGTGGCCTCTGGAGGAGAGTGG - Intronic
1007698033 6:43746316-43746338 CAGTGGTCTCTGGGGGAGGAGGG + Intergenic
1008179101 6:48305547-48305569 AAGTGGCCTCTAGATGAGGAAGG + Intergenic
1008746100 6:54671344-54671366 CTGTGTCCTCTGCAGGATAATGG + Intergenic
1011218287 6:85028804-85028826 CAGAGTGCTGTGGAGGAGAAGGG - Intergenic
1011556247 6:88573792-88573814 CTGTGTGCTCTGGAGAAGGAGGG - Intergenic
1012950195 6:105510083-105510105 CAGTATCCTTTGGAGTTGGAGGG + Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1014884179 6:126759497-126759519 CAGTGTCTTCTACATGAGGAAGG - Intergenic
1015330189 6:131968836-131968858 CCATGTGCTCTGGAGGAAGAAGG + Intergenic
1016195316 6:141329088-141329110 CTGTGTCCTCTTGTGGTGGAAGG - Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1017530681 6:155289228-155289250 CAGGGTCCTCTGGAGATGGTGGG + Intronic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019131951 6:169883363-169883385 CAGTGTCCTCTGGGTTATGAGGG + Intergenic
1019162419 6:170077709-170077731 CTGTGTCCTCTGGTGGTGAAGGG + Intergenic
1019213404 6:170424121-170424143 CTGTGTCCTGTGCAGGAGGTAGG - Intergenic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019691632 7:2417987-2418009 CAGTGTCTTCCAGAGCAGGATGG + Intronic
1019961189 7:4461328-4461350 CAGCTTTCTCTGGAGGAGGAGGG - Intergenic
1020308649 7:6853824-6853846 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
1022633186 7:32105379-32105401 CATGGTCCTCTGGAAGAGAAAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025046338 7:55695340-55695362 CAGTTTCCTCTGAAGGGGGTGGG + Intergenic
1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG + Intronic
1028871410 7:95774370-95774392 CACAGTCCCCTGGAGGAGGAGGG + Intronic
1029414628 7:100435378-100435400 CAGTGTCCGGTGCATGAGGAAGG + Exonic
1029507678 7:100972104-100972126 CAGAGCCCTCTGCAAGAGGAGGG - Intronic
1029840291 7:103355446-103355468 CAGTGTCCTCTGGGAGGGGTTGG - Intronic
1029989071 7:104946489-104946511 AAGCATGCTCTGGAGGAGGATGG + Intergenic
1030842655 7:114375295-114375317 CATTATACTCTCGAGGAGGAAGG - Intronic
1032193262 7:129776230-129776252 AAGAGTCCTCGGGAGCAGGAAGG - Intergenic
1032488185 7:132304264-132304286 CTGTGTCCTCTGTAGTAGGGAGG + Intronic
1032665090 7:134028082-134028104 TAGAATCCTCTGGAGGAGGAGGG + Intronic
1032720731 7:134549164-134549186 CACTGTCTTCTGGAGGGGAACGG + Exonic
1033234808 7:139629851-139629873 AAGAGTCCTCCGGTGGAGGAGGG - Intronic
1033368641 7:140689939-140689961 CAGCGACCCCTGGATGAGGAAGG - Intronic
1033568392 7:142602050-142602072 GAGTGTCCTGTGGAAGAAGACGG - Intergenic
1033657325 7:143382391-143382413 CCGCCTCCTCCGGAGGAGGAGGG + Exonic
1034657884 7:152743799-152743821 CAGTGTCCTCTCCTGGTGGAAGG + Intergenic
1034859201 7:154581708-154581730 CAGTGTCCCCTGCAGGTGCAGGG + Intronic
1034879646 7:154753426-154753448 CTGTCTCCTGTGGAGGATGATGG - Intronic
1034890023 7:154831340-154831362 CAGTGGCCCCTGGAGTAGGGAGG - Intronic
1035455503 7:159006254-159006276 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455537 7:159006406-159006428 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455546 7:159006444-159006466 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455563 7:159006520-159006542 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1036644941 8:10607184-10607206 GAGGATGCTCTGGAGGAGGAAGG + Exonic
1037586465 8:20280087-20280109 CTGTCTCCTGTGTAGGAGGATGG - Intronic
1038397589 8:27258505-27258527 CAGTCTCCTCTGGTGGAGCAGGG + Intergenic
1038450645 8:27636981-27637003 GTGTGGCCTCTGGAGGAGCACGG - Intronic
1038537273 8:28362331-28362353 ACGTGTGCTCTGTAGGAGGAGGG - Intronic
1039159011 8:34595942-34595964 CAGTGTCCTGAGGATGAGCATGG + Intergenic
1039433759 8:37545646-37545668 TCGTGGCCTGTGGAGGAGGACGG - Intergenic
1041078024 8:54186938-54186960 GAAAGTCATCTGGAGGAGGATGG - Intergenic
1041340052 8:56835392-56835414 CAGTCTCCTCTGGAGCAGCCAGG - Intergenic
1048172662 8:132122591-132122613 CAGTGCTATCTGGAGGATGAAGG + Exonic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049291446 8:141805074-141805096 TAGTGTCCTCTAAAGGCGGAAGG - Intergenic
1049494629 8:142923962-142923984 CAGTGTCCTCTGGATGGGAGGGG - Intergenic
1049562225 8:143317541-143317563 CAGAGTCCTGGGGAGGAGGAGGG - Intronic
1049592682 8:143469691-143469713 GGGTGCCATCTGGAGGAGGAGGG + Intronic
1050846428 9:10226377-10226399 CAGTTTCCTCTCCAGGTGGAGGG + Intronic
1051093410 9:13436985-13437007 CAGTGACTTCAGGAGGAGGCTGG - Intergenic
1051154566 9:14126483-14126505 CAGTCTCCCCAGGATGAGGAAGG + Intronic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1054952935 9:70873299-70873321 CAGTGTTCTCTGGAGGCAGCTGG - Intronic
1055410586 9:76025026-76025048 AAGTGTCCTTTGGAGCACGAAGG - Intronic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1056692722 9:88822100-88822122 CAGTGTCTCTTGGTGGAGGAAGG + Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1056947973 9:91016936-91016958 CAGAGTCCTCTGCAGGATTATGG - Intergenic
1057318805 9:93992653-93992675 CTGTGTCCTCTGGAGGAGAAGGG - Intergenic
1058259443 9:102811096-102811118 CAGTTACCTCTGGGGAAGGATGG + Intergenic
1058420145 9:104825772-104825794 GAGAGTCCTGTGGAGGAAGATGG - Exonic
1058429457 9:104905150-104905172 CTGTGGCCTCTAGAGGAGTAGGG + Intronic
1059905673 9:118983057-118983079 AAATGTCCTCTGGTGGAGGTTGG - Intergenic
1060910323 9:127344602-127344624 CTGTGTTCTCTGGAAGAGGGGGG - Intronic
1061645571 9:131998294-131998316 AAGTGACCAATGGAGGAGGAAGG - Intronic
1062141983 9:134964326-134964348 CAGTGCCCAGTGGAGGAGGAGGG + Intergenic
1062447860 9:136603229-136603251 CAGTTTCCTCTGGTGTAAGACGG - Intergenic
1062613398 9:137385256-137385278 AAATGTCCACTGTAGGAGGACGG + Intronic
1062723468 9:138057842-138057864 CAGTGTCCACGGGAGAAGGCTGG + Exonic
1203769582 EBV:42201-42223 CAGTGTCCTCTGGCGAAAGGCGG - Intergenic
1188049390 X:25466043-25466065 CAGTCTCCACTGAAGGGGGAAGG + Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189379076 X:40488977-40488999 CAGGCGCCTCTGGAGGAGGGTGG - Intergenic
1189394105 X:40604650-40604672 CAGTTACCTCTGGATGAGGGAGG - Intronic
1190989276 X:55528622-55528644 CTCAGTCCTCTGGAGGGGGAAGG - Intergenic
1191846411 X:65550828-65550850 CATTGTCCTCCTGAGGAGCAGGG - Intergenic
1192359861 X:70432646-70432668 CACTCACCTTTGGAGGAGGAAGG - Exonic
1192582824 X:72299225-72299247 CAGTGCCTTCAGGAGGGGGATGG - Intronic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1197275096 X:124468553-124468575 TAGTTACCTCTGGAGAAGGAAGG - Intronic
1199512188 X:148634856-148634878 GAGTGTCCACTGGGTGAGGAAGG - Intronic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic
1201859549 Y:18581646-18581668 CAGTGTCCTCTAATGGTGGAAGG + Intronic
1201873772 Y:18738735-18738757 CAGTGTCCTCTAATGGTGGAAGG - Intronic