ID: 1104071934

View in Genome Browser
Species Human (GRCh38)
Location 12:125353406-125353428
Sequence TAGAGGAAAAGGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1060
Summary {0: 1, 1: 0, 2: 6, 3: 88, 4: 965}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104071926_1104071934 10 Left 1104071926 12:125353373-125353395 CCTGATATAGAGATAATATTTTG 0: 1
1: 0
2: 2
3: 30
4: 299
Right 1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 88
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104071934 Original CRISPR TAGAGGAAAAGGAGGGCAGA TGG Intronic
900377522 1:2362973-2362995 CAGAGGAAAATGAGAGCAGATGG + Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901137169 1:7005459-7005481 AAGAAGAAAAAGAAGGCAGAAGG - Intronic
901237777 1:7676672-7676694 TTCCGGAAAAGCAGGGCAGAAGG + Intronic
901498839 1:9639004-9639026 GGGAGGACAAGGTGGGCAGATGG - Intergenic
902816810 1:18921133-18921155 AAGAGGAACAGGTGGTCAGAAGG + Intronic
902846347 1:19113555-19113577 TAGCTGAAAAGGCAGGCAGATGG - Intronic
903270867 1:22187479-22187501 TGGAGGAAGGGGAGGGGAGAGGG - Intergenic
903273842 1:22208560-22208582 TTGAGGAAACTGAGGCCAGAGGG + Intergenic
903331782 1:22600302-22600324 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
903516688 1:23915999-23916021 AAGAGGAAAAGAAGACCAGAAGG + Intergenic
904158146 1:28502043-28502065 TATAGGAAAAGCAGGAGAGAGGG - Intergenic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
904576377 1:31507640-31507662 TGGAGGAGAGGAAGGGCAGAGGG + Intergenic
904727187 1:32558136-32558158 TGGGGGAAAAGGAGGGAAGTAGG + Intronic
904763984 1:32827965-32827987 TTGAGGAAAAGGAATGCAAAAGG - Intronic
905165167 1:36077039-36077061 TTGAAGATAAGAAGGGCAGATGG + Intergenic
905316151 1:37082677-37082699 AAGAGGAGATGGAGGGCAAAGGG + Intergenic
905349884 1:37338126-37338148 AGGAGGAGAAGGAGGGGAGAGGG + Intergenic
906892554 1:49733097-49733119 CAGAGCCAAAGGAGGCCAGAAGG + Intronic
907359750 1:53904901-53904923 AGGAGGAAGAGGAGGGGAGAGGG + Intronic
907449558 1:54535478-54535500 GGGAGGCCAAGGAGGGCAGATGG + Intergenic
907922844 1:58929522-58929544 GAGAGCATAAGGAGGGCGGAGGG - Intergenic
908065806 1:60403137-60403159 TAGAGAAAAAGGGGGGCTGAAGG + Intergenic
908341544 1:63185294-63185316 CAGAGGAGAAGGACGGCATAAGG + Intergenic
908504189 1:64778825-64778847 AAGAGGAAAAGGAGCGTGGATGG - Intronic
908738200 1:67298844-67298866 TAGAGTAATAGGAGGTGAGAAGG + Intergenic
908928941 1:69292634-69292656 TTTAGGAAAAGTAGGGCAGTTGG - Intergenic
908953307 1:69589206-69589228 CAGAGGAAGAGGATGGCACAGGG - Intronic
909329650 1:74396160-74396182 TAGAGGACAGGGAGATCAGAGGG + Intronic
910430839 1:87158319-87158341 GAGAGGGAAAGGAAGGAAGATGG - Intronic
910773440 1:90851740-90851762 CAGGGGAAAAGGAGGCCAGCGGG - Intergenic
912379683 1:109240667-109240689 GGGAGGAAAAGCAGGACAGACGG - Intergenic
912393208 1:109319248-109319270 AACAGGAAAAGGAGAGCAGTGGG - Intronic
912551805 1:110489761-110489783 CAGAGGAACAGGAGGTCAGACGG - Intergenic
912730159 1:112095092-112095114 GAGAGGAAAATGAGGTCAAATGG + Intergenic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
913046498 1:115077887-115077909 TCCAGGAAAAGGAGGACAGCTGG - Intronic
913074381 1:115329058-115329080 AAGAGGAAAAGAAGAGGAGAAGG + Intronic
913305413 1:117425144-117425166 AGGAAGAAAAGGAGGGCAAAGGG + Intronic
913320129 1:117582269-117582291 TACAGGAAATGGGGAGCAGAAGG - Intergenic
913669559 1:121083321-121083343 AAGAGGAAAAGGATGGGAAAAGG - Intergenic
913675871 1:121139691-121139713 GGGAGAAAAAGGAGGGCAGGAGG - Intergenic
914021316 1:143870720-143870742 AAGAGGAAAAGGATGGGAAAAGG - Intergenic
914027767 1:143927631-143927653 GGGAGAAAAAGGAGGGCAGGAGG - Intergenic
914224295 1:145707592-145707614 CAGAGAACAAGGAGGGGAGAGGG + Intronic
914330279 1:146662914-146662936 CAGAGGATAAGAAGGGTAGAGGG + Intergenic
914374241 1:147059504-147059526 TAGAGGAAGAGGGGGGCATGAGG + Intergenic
914659807 1:149778638-149778660 AAGAGGAAAAGGATGGGAAAAGG - Intergenic
914758908 1:150583056-150583078 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915106593 1:153538537-153538559 TGGAGGTTAATGAGGGCAGAGGG - Intronic
915452206 1:156013887-156013909 CAGATGAAAAGGAAGGCAGAAGG + Intronic
915493640 1:156266031-156266053 TGGAGGAAGAGGAGGGGACACGG - Exonic
915562122 1:156693445-156693467 GAGAGGAAAGGGAGGGGACAGGG - Intergenic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
916126885 1:161579643-161579665 TAGAGGAAAAGCAGGCTGGAGGG - Intergenic
916136804 1:161661447-161661469 TAGAGGAAAAGCAGGCTGGAGGG - Intronic
916320786 1:163501444-163501466 TAGTTGAAAAGGAGCACAGAGGG - Intergenic
916531552 1:165661112-165661134 CAGGTAAAAAGGAGGGCAGAAGG + Intronic
918003651 1:180521833-180521855 TATACAAAAAGGAGGGAAGAAGG - Intergenic
918205069 1:182300893-182300915 TTGAGGACAAGGAGGACCGAAGG - Intergenic
918579519 1:186109734-186109756 TACAGGAAAAGGAAGGCTGCTGG + Intronic
918629184 1:186695424-186695446 AAGAGGAAAAGGAGGTAAAAGGG - Intergenic
918692963 1:187505236-187505258 TGGAGGAAAAGGAGGGATGTTGG + Intergenic
919760136 1:201092556-201092578 GAGAGGAAGAGGAGGCCAGTAGG - Intronic
920181581 1:204135106-204135128 GAGAGGAAAAGGAGTGGAGGAGG - Intronic
920209757 1:204319787-204319809 GGGAGGAAAGGGAGGACAGAAGG + Intronic
920463239 1:206158528-206158550 GGGAGAAAAAGGAGGGCAGGAGG - Intergenic
920724673 1:208422981-208423003 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
920754603 1:208717147-208717169 TAGAACAAAAGGGAGGCAGAGGG - Intergenic
920948789 1:210553800-210553822 GAGAGGAAGAGGTGGGAAGAGGG - Intronic
921963537 1:221062695-221062717 TAGAGGAAAAAGGAGGCAGAGGG - Intergenic
922066862 1:222152566-222152588 AGGGGTAAAAGGAGGGCAGATGG + Intergenic
922347546 1:224708802-224708824 AAGAGGAAAACAAGGGCAGAAGG - Intronic
922574922 1:226655082-226655104 AGGAGGAAGAGGAGGGCAGGAGG + Intronic
922746184 1:228045463-228045485 TAGAAGGGAAGCAGGGCAGATGG + Intronic
923133539 1:231097835-231097857 AAGAAGAAAAGGGGGGCAGAGGG - Intergenic
923935800 1:238758854-238758876 GAGTAGAAAAGGAGGGCAAATGG + Intergenic
924051778 1:240086327-240086349 TAAATGAAAAGGAGGTGAGAAGG + Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924139998 1:241012374-241012396 TGCAAGAAAAGGAAGGCAGAGGG + Intronic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
924671666 1:246133539-246133561 TACAGGAAAAGAAGGGCCAAAGG + Intronic
1063122559 10:3115029-3115051 TGGAGGGCACGGAGGGCAGATGG + Intronic
1063308842 10:4933817-4933839 CAGAGGAAAAGGAGGAAAGACGG - Intronic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1063484867 10:6410448-6410470 GGGAGGAAATGTAGGGCAGAGGG + Intergenic
1063603627 10:7504813-7504835 AAGAGGAAAAGAAAGGCAAATGG + Intergenic
1064295161 10:14072793-14072815 TAAAGGAAAATGAGGTGAGATGG + Intronic
1064471016 10:15636072-15636094 TGGAGGAAAACATGGGCAGAAGG - Intronic
1064484087 10:15766986-15767008 TGGAGGCCAAGGTGGGCAGATGG - Intergenic
1064560434 10:16590170-16590192 TGGAGGACGAGGCGGGCAGATGG + Intergenic
1064627243 10:17273848-17273870 GAGAGGAGGAGGAGGGAAGAAGG - Intergenic
1064929690 10:20611183-20611205 TAGAGCAAGAGTAGGGTAGATGG - Intergenic
1065185292 10:23164978-23165000 AAGAGGAAAAGGGAGGAAGAAGG + Intergenic
1065478101 10:26163123-26163145 TAGGGATATAGGAGGGCAGAAGG + Intronic
1065480993 10:26193670-26193692 TAGAAGAAAAGGAAAGAAGAGGG + Intronic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066216813 10:33296329-33296351 TAAAAGAAAAGGAGACCAGAAGG - Intronic
1066229635 10:33419745-33419767 TCTAGGAAATCGAGGGCAGAGGG + Intergenic
1066425811 10:35306695-35306717 AAAAGGAGAAGGAGGGGAGAGGG - Intronic
1067304848 10:45053185-45053207 TAGAGGAAGAGTAGGTCTGATGG + Intergenic
1067516117 10:46946284-46946306 TCTAGGTAAAGGAGGGGAGAAGG + Intronic
1067646131 10:48105526-48105548 TCTAGGTAAAGGAGGGGAGAAGG - Intergenic
1068148725 10:53104786-53104808 AAGAGACAGAGGAGGGCAGAAGG + Intergenic
1068699664 10:60006550-60006572 TAGAGCAAAAGGATGCTAGAGGG - Intergenic
1070100513 10:73381778-73381800 CAGAGTAACAGGAGGGCAGTAGG - Intronic
1070430414 10:76332339-76332361 TGGAGGAAAAGGAGAGGAAATGG - Intronic
1070891821 10:79946814-79946836 TTAAGGACAAGGAGGGCACAAGG + Intronic
1071015369 10:80990598-80990620 TTGAGGAAAAGGATGGGAGGAGG - Intergenic
1071138827 10:82483067-82483089 TCCAGGAAAGGCAGGGCAGATGG + Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071305987 10:84299139-84299161 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1071417631 10:85455975-85455997 TAGAGGACACTGAGGGCAGATGG + Intergenic
1071887589 10:89967841-89967863 AAGAGGAAAAAGAGGAAAGAAGG - Intergenic
1072032754 10:91537080-91537102 GGGAGGATCAGGAGGGCAGAGGG + Intergenic
1072231279 10:93416005-93416027 TGGTGGACTAGGAGGGCAGAGGG - Intronic
1072757164 10:98029334-98029356 AAGTGGAAAAGAAGGGAAGAGGG - Intronic
1072967904 10:99990311-99990333 GAGAGGCTAAGGTGGGCAGATGG + Intronic
1073303614 10:102485961-102485983 TGGAGGACAAGGAGGGGAGTTGG - Intronic
1073340904 10:102743952-102743974 AACAGGAAAAGAAGGGAAGAAGG + Exonic
1073562247 10:104506797-104506819 AGAAGGAAAAGGAGGGCTGAAGG - Intergenic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073857823 10:107697596-107697618 GAGAAGAAAAGGAGAGGAGAAGG - Intergenic
1073920045 10:108448389-108448411 AAGAGGAAGAGGAGGGATGATGG + Intergenic
1074615869 10:115067746-115067768 TAGAGGAAAGGAAGGAGAGAAGG + Intergenic
1075061291 10:119258775-119258797 GAGAGGAAAAGGAAGGTAGCTGG + Intronic
1075499249 10:122957239-122957261 GAGAGGGAAAGGAGGAGAGAAGG - Intronic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1075581142 10:123619533-123619555 TAGAAGAGAAGGAGGGAAAAGGG + Intergenic
1075646495 10:124100220-124100242 TGGCAGAAAAGGAGGGCAGAGGG - Intergenic
1075912141 10:126133718-126133740 TAGAGAGAAATGAGGTCAGAAGG - Intronic
1075962994 10:126585394-126585416 AGGAAGAAAAGGAGGGAAGAAGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076319038 10:129564714-129564736 CAGAGGAAAAGAAGGGCAGGAGG - Intronic
1077383869 11:2259960-2259982 GAGAGGACATGGAGGGCTGAGGG + Intergenic
1077392524 11:2306791-2306813 AGGAGGAAAAGGAGGGAAAAGGG + Intronic
1077428936 11:2505214-2505236 CAAAGAAAAAGGGGGGCAGAGGG - Intronic
1077483556 11:2827836-2827858 AAGAGGAAGGGGCGGGCAGAAGG + Intronic
1077484274 11:2831725-2831747 GAGAGGCAGAGGAGGGCAGCGGG - Intronic
1077670668 11:4154516-4154538 TAGGGGCAAAGGTGGGCACAGGG - Intergenic
1077798191 11:5512969-5512991 TAGAGGAAAACCAGGGAAGCAGG - Intronic
1078032159 11:7763919-7763941 TGGTGAAAAAGCAGGGCAGAAGG + Intergenic
1078469511 11:11575764-11575786 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
1079333167 11:19549927-19549949 GAGAGCAAAAGAAGGGGAGATGG + Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1079900349 11:26175270-26175292 TAGAGGAAAAGCAGAGAAAATGG - Intergenic
1080117317 11:28635491-28635513 AAGAAGAAAGGGAGGGCAGGAGG + Intergenic
1080276925 11:30513189-30513211 TAGAATAAAAGTAGGGCAGGAGG - Intronic
1080374359 11:31690328-31690350 TGAAGGAAAGTGAGGGCAGATGG - Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080818938 11:35786944-35786966 TATAGGATGGGGAGGGCAGAAGG - Intronic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081459068 11:43254258-43254280 TAGAGAAAGAGGAGGGAAGAGGG - Intergenic
1081525516 11:43925056-43925078 GAGAGGGAAAGGAGGACAGCTGG + Intergenic
1081634954 11:44714849-44714871 GAGAGGGAAAGAAGGGAAGATGG + Intergenic
1081656699 11:44862132-44862154 TAGAGGGACAGGGGAGCAGAGGG + Intronic
1081742037 11:45447727-45447749 AATAGGAAATGGAGGGCAGGAGG + Intergenic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1081997850 11:47376602-47376624 GGGAAGAAAAGGAGGACAGAGGG - Intronic
1082008370 11:47433876-47433898 TATAGGAAGAGGAAGACAGAGGG + Intergenic
1083116773 11:60467722-60467744 TAGGTGAAAAGGAGGGAAGAGGG - Intronic
1084495613 11:69501451-69501473 GAGAGGAAAAGGAGTGGGGAGGG + Intergenic
1084504303 11:69555434-69555456 GATAGTAAAAGGAAGGCAGAAGG + Intergenic
1084596513 11:70119915-70119937 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
1085309983 11:75510507-75510529 GGGAGGAAAAGGAGGTCAGACGG - Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085460296 11:76689364-76689386 TTTAGGAAAAGGAGGGCAGCAGG + Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085604614 11:77885836-77885858 GAAAGAAAAAGAAGGGCAGAGGG + Intronic
1085760091 11:79234196-79234218 CAGAGGAAAAGAAGGTCAAAGGG - Intronic
1085992249 11:81863330-81863352 AAGAGGAGAAGAAGGGAAGAAGG + Intergenic
1086791157 11:91039766-91039788 TAGAAGAAAATGAGGATAGAAGG + Intergenic
1087061090 11:93978335-93978357 GAGAGGAAAAGGATAGCAGTTGG - Intergenic
1087701531 11:101441315-101441337 TTGGGGAAATGGGGGGCAGATGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088675195 11:112186105-112186127 TAGAAGAGAAGGAGGGCAAAGGG + Intronic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088728466 11:112659818-112659840 AAGAGGACTAGGAGGACAGAGGG - Intergenic
1088879301 11:113961051-113961073 AGGAGGAACAGGAGGCCAGAAGG + Intergenic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1089027685 11:115288936-115288958 TACAGGAACAGGAGGGAGGAGGG - Intronic
1089434914 11:118456681-118456703 TGAAAGAAAAGGAGGGTAGATGG - Intronic
1089710052 11:120308089-120308111 TAGAAGGAAATGAGGTCAGATGG - Intronic
1090062690 11:123477601-123477623 GAGAGGGAAAGGAAGGGAGACGG - Intergenic
1090184267 11:124725947-124725969 CAGAGGCAAAGGAGGACAGCTGG + Intergenic
1090696489 11:129248729-129248751 TACAGGAAAAGGAGGAGAGGAGG - Intronic
1090730151 11:129565708-129565730 TAAAGGAAAATGATGCCAGATGG + Intergenic
1091070523 11:132558431-132558453 TAGGGGAAGAGGAGGGGAGGAGG - Intronic
1092205683 12:6613232-6613254 GAGAGGAAATGGAGGGGAGGGGG + Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1092552253 12:9515435-9515457 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1092571023 12:9721129-9721151 AAAAGGAGAAGGAGGGCAGAGGG - Intronic
1093340636 12:17968692-17968714 TACAGCAAAAGGTGGGCAGCAGG + Intergenic
1093513565 12:19957961-19957983 TAAAGGTAAGGGAGGGCAGGGGG - Intergenic
1093629521 12:21391933-21391955 GGGAGAAAAAGGAAGGCAGAAGG - Intronic
1094143711 12:27206966-27206988 TATACTAAAAGGAGAGCAGAGGG - Intergenic
1094452810 12:30600638-30600660 GAGAGGAAAATGTGGGCAAACGG + Intergenic
1094519866 12:31175176-31175198 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1095959138 12:47822935-47822957 GAGAGGAAAAGGAGAAGAGAAGG - Intronic
1095991517 12:48037673-48037695 TGGAGGAGAGGGAGGGCACAAGG + Intergenic
1096009494 12:48201119-48201141 AAGAGAAAAAGGAAGGCAGTAGG + Intergenic
1096241055 12:49960760-49960782 GAGAGGAAGAGGCTGGCAGAGGG + Intergenic
1096318992 12:50593905-50593927 GAGAGGAAAAGGAGAGGGGAGGG - Intronic
1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG + Intronic
1096489998 12:52007927-52007949 CAGAGGAAGAGGCTGGCAGAGGG - Intronic
1096750681 12:53756932-53756954 TGGATAAAAAGGAGGGGAGAGGG + Intergenic
1096780262 12:53987627-53987649 TAGAGGAAAGGGAGAGCCTATGG - Intronic
1097008348 12:55934994-55935016 TGGAACAAGAGGAGGGCAGAGGG + Intronic
1097827446 12:64188553-64188575 GAGAGGAAAAGAAGGAAAGAGGG + Intronic
1097973378 12:65659201-65659223 AGGAGGAGAAGGAGGGCAGCAGG - Intergenic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1099151602 12:79121152-79121174 CAGAGGAGAAGGAAGACAGAAGG - Intronic
1099224179 12:79949414-79949436 TAGAGAGGAAGGAGGACAGAGGG - Intergenic
1099722040 12:86376144-86376166 GGGAGGCCAAGGAGGGCAGATGG + Intronic
1100372609 12:93982233-93982255 CAGAAGAAAAGAAGGCCAGAAGG + Intergenic
1100761707 12:97814676-97814698 AAGAGGAAAAAGAGGATAGAGGG + Intergenic
1101173356 12:102122453-102122475 TAGAAGAAAAGGATAGCAGAAGG + Intronic
1101348612 12:103907318-103907340 GAGGGGAAAAGGAGGGGAGGGGG + Intergenic
1101756771 12:107627268-107627290 TAGAGAAAAAGGAGGCCAGAGGG - Intronic
1101843235 12:108342398-108342420 GAGAAGAGAAGGAGGCCAGAAGG + Intergenic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102058753 12:109916122-109916144 CCTAGGTAAAGGAGGGCAGAGGG - Intronic
1102292426 12:111712004-111712026 TAGAGGAAAACAAAGGAAGAAGG - Intronic
1102753437 12:115316703-115316725 AAGAAGAAAAGAAGGGAAGAAGG + Intergenic
1102797125 12:115698286-115698308 GAGGGGAAAAGGAGGGGAAAGGG + Intergenic
1102838850 12:116096112-116096134 GAGAGGCCAAGGTGGGCAGATGG + Intronic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103514920 12:121501215-121501237 TACAAGAAAATGAAGGCAGATGG + Intronic
1103623006 12:122200320-122200342 TGGAGGAGAAGGTGGGCAGGCGG + Exonic
1104071934 12:125353406-125353428 TAGAGGAAAAGGAGGGCAGATGG + Intronic
1104415999 12:128597048-128597070 TTGAGGAAAAGGTGGAGAGAAGG - Intronic
1104517769 12:129443575-129443597 TAGAGAAAGAGGAAGGGAGAAGG - Intronic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1104913108 12:132249803-132249825 TACAGAAAAAGGTGGGCTGAGGG + Intronic
1105211118 13:18257748-18257770 TAGCCAAAAGGGAGGGCAGAGGG + Intergenic
1105645396 13:22312633-22312655 CAGAGGAAGAGGAGGAGAGAGGG - Intergenic
1105907605 13:24828584-24828606 AAGAGAAAAAGGAGGACAAAAGG - Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106546297 13:30733745-30733767 TAGAACAAAAAGCGGGCAGAAGG + Intronic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1107794445 13:44035562-44035584 GAGAAGAAAAGGAGGGAAGGAGG + Intergenic
1108086994 13:46803894-46803916 TAGAATGAAAGGAGGGCAGGTGG + Intergenic
1108162080 13:47651306-47651328 TAGAGGAGAACAATGGCAGATGG + Intergenic
1108878079 13:55073135-55073157 CAGAGGGAAAGGAGAGCAGGAGG + Intergenic
1109442841 13:62397821-62397843 TTAAAGAAAAGGAGTGCAGAAGG + Intergenic
1110241680 13:73274595-73274617 TAGAGGAACAGGGGGGCTGTTGG - Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110565415 13:76952891-76952913 CAGAGGCCAAGGTGGGCAGACGG + Intronic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1111093438 13:83477388-83477410 AAGAGGAAAAGGAGAAGAGAAGG + Intergenic
1111842131 13:93462892-93462914 TAGAGCAGAAGCGGGGCAGAGGG - Intronic
1111864338 13:93750168-93750190 TAAAGACAAAGGAGGGCAAAAGG + Intronic
1111954671 13:94743222-94743244 TAGAGGAAAGGGAGGGCTGCAGG - Intergenic
1112547290 13:100383229-100383251 GAGAGGCCAAGGTGGGCAGATGG - Intronic
1112927422 13:104693755-104693777 AGGTGGAAAAGGAAGGCAGAAGG + Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113145579 13:107203927-107203949 TGGAGGCAGAGGGGGGCAGAGGG + Intronic
1113159600 13:107364989-107365011 TGGAGGAAGAGGAGGGGAGGGGG - Intronic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113754854 13:112804036-112804058 AGGAGGAAAAGGAGGGAAGGAGG - Intronic
1114482369 14:23043877-23043899 GAGAGGAAAGGCAGGGCAGAGGG - Exonic
1114576483 14:23719114-23719136 AAGAGGAAAAAGAGAGAAGAAGG + Intergenic
1114798425 14:25743076-25743098 TAGAGGAAAAGGAAAGATGAAGG + Intergenic
1114824952 14:26065844-26065866 GAGAGGAAAATGAGTTCAGACGG - Intergenic
1114830226 14:26131960-26131982 TAGAGAAAGAAGAGGGCATAGGG + Intergenic
1115267369 14:31514549-31514571 TGGTGGAAAAGGAAGCCAGAAGG + Intronic
1115430771 14:33315798-33315820 GAGAGTAAAAGGAGACCAGAGGG + Intronic
1115525357 14:34274741-34274763 GAGAGGACTAGGAGGGCAGATGG - Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116406038 14:44567689-44567711 TAGCAGACAAGGTGGGCAGATGG + Intergenic
1116635327 14:47387346-47387368 TAGAGGGAAAGGATGGAAGCTGG + Intronic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117508142 14:56422968-56422990 AGGAAGAACAGGAGGGCAGAGGG + Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117590744 14:57265618-57265640 TGGAGGCTAAGGTGGGCAGATGG + Intronic
1118764032 14:68898278-68898300 TAAGGGAAGAGGAGGGGAGAGGG + Intronic
1119190105 14:72675600-72675622 TGGAGGAAGTGGAGGCCAGAGGG - Intronic
1119541254 14:75439560-75439582 TAGAGGTAAATGAAGGCAGATGG - Intronic
1120302972 14:82731760-82731782 GAGAGGAAAAGCAGGCCTGATGG + Intergenic
1121287471 14:92747782-92747804 TAGATGAAAAGGAGTGCCCAGGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121618912 14:95332582-95332604 AAGAAGAAAGGGAGGGCGGAGGG - Intergenic
1121648836 14:95540539-95540561 TAGAGGAAAAGCAAGGCACGGGG - Intronic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1122181535 14:99958607-99958629 CAGAGGCACAGGAGGTCAGAGGG + Intergenic
1123395766 15:19933483-19933505 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1124174085 15:27405873-27405895 TAGAGGAAAATGTAGGCAAATGG + Intronic
1124346386 15:28924167-28924189 TTGAGAACAAGGAGGGGAGAGGG - Intronic
1124501718 15:30233788-30233810 AAGAGGAAAAAGAGGGGAGAAGG - Intergenic
1124598869 15:31114644-31114666 CAGAAGCAAAGAAGGGCAGAAGG + Intronic
1124741847 15:32304863-32304885 AAGAGGAAAAAGAGGGGAGAAGG + Intergenic
1125181543 15:36885337-36885359 TAGAGAAAAAGGAAGGCAGGTGG + Intergenic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125453330 15:39831788-39831810 TGGAGGATACGGAGGGCTGATGG - Intronic
1125681222 15:41531409-41531431 TAGAGGGAAAGGTGGGCAGGTGG - Intronic
1125897279 15:43313236-43313258 TGGAGTAAAAGGTGGGCAAAGGG - Intergenic
1125932291 15:43609106-43609128 TGGAAGGAAAGGAGGGCAAAGGG + Intronic
1125945387 15:43708578-43708600 TGGAAGGAAAGGAGGGCAAAGGG + Intergenic
1126332241 15:47545860-47545882 AAAATGATAAGGAGGGCAGATGG - Intronic
1126385629 15:48090581-48090603 GATAGGAAAAGAAAGGCAGAGGG + Intergenic
1126402960 15:48293146-48293168 GGGAGGATAAGGCGGGCAGATGG - Intronic
1126820444 15:52497785-52497807 AAGAAGAAATTGAGGGCAGAAGG + Intronic
1126859391 15:52869608-52869630 TAGCAGAAAGGAAGGGCAGAAGG + Intergenic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1126978669 15:54216143-54216165 TAGAGGCAAAGGAGGGGTAAAGG + Intronic
1127146694 15:56032466-56032488 TGGAGGAAGAGGAGGCCAGAGGG - Intergenic
1127515121 15:59686308-59686330 TGGAGGACAAGGTGGGAAGATGG + Intronic
1127521605 15:59748204-59748226 TGGAGGACATGGAGGGCAGGAGG - Intergenic
1127544375 15:59976541-59976563 ATGAGAAATAGGAGGGCAGAAGG + Intergenic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128815899 15:70607998-70608020 TAGAGGAAAATGTGGGCTCAAGG + Intergenic
1129719755 15:77871653-77871675 TAGAGGATAAGCAGGTCACAGGG + Intergenic
1131823900 15:96301019-96301041 GAAAGGAAAAGCAGGGCAGGAGG - Intergenic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132593579 16:737746-737768 CACAGGAAGAGGAGAGCAGAGGG + Intronic
1133403439 16:5505200-5505222 TAGAGGAGAAGGGGGCAAGAAGG - Intergenic
1133525779 16:6603958-6603980 GAGAAGAAAAGGAGATCAGAGGG - Intronic
1133685531 16:8162179-8162201 AACAGGGAAAGGGGGGCAGAGGG + Intergenic
1133839830 16:9397634-9397656 TAGAGAAACAGGAAGGAAGATGG - Intergenic
1133908006 16:10039182-10039204 GAGTGGAAAAGAAAGGCAGAGGG + Intronic
1134275321 16:12770823-12770845 GAAAGGAAAGGGAGGGCAGAAGG + Intronic
1134299050 16:12973246-12973268 AAAAGGAAAAGAAGGGCAAAAGG - Intronic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134485123 16:14651825-14651847 TAGAGTGAAAGGAGAGCAGGAGG + Intronic
1134523322 16:14928123-14928145 GAGAGGAGGAGGAGGGGAGAGGG - Intronic
1134710918 16:16326607-16326629 GAGAGAAGGAGGAGGGCAGAAGG - Intergenic
1134948666 16:18342002-18342024 GAGAGAAGGAGGAGGGCAGAAGG + Intergenic
1135117045 16:19732700-19732722 GGGAGGCCAAGGAGGGCAGATGG - Intronic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1135936668 16:26786225-26786247 TTGAGGAAAAGGGAGGCAGATGG + Intergenic
1136224457 16:28849334-28849356 GAGAGGCCAAGGTGGGCAGACGG - Intronic
1136692756 16:32047550-32047572 CAGAGGAAAAGCTGGGTAGAGGG - Intergenic
1136698206 16:32105613-32105635 AAGAGGAAAGGGAGGGAGGAAGG + Intergenic
1136793250 16:32990775-32990797 CAGAGGAAAAGCTGGGTAGAGGG - Intergenic
1136876602 16:33863282-33863304 CAGAGGAAAAGCTGGGTAGAGGG + Intergenic
1136935612 16:34461147-34461169 AAGAAGAAAAGGAGGGCGGGAGG - Intergenic
1136939663 16:34510984-34511006 AGGAGGAAAAGGAGGGCGGGAGG - Intergenic
1136960157 16:34837576-34837598 AGGAGGAAAAGGAGGGCGGGAGG + Intergenic
1136964206 16:34887423-34887445 AAGAAGAAAAGGAGGGCGGGAGG + Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137557137 16:49477610-49477632 AAGAGGAGGAGGAGGGAAGAAGG + Intergenic
1137785385 16:51133981-51134003 GGGAGGAGAAGCAGGGCAGAGGG + Intergenic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1137879611 16:52032638-52032660 GAGAAGAAAGGCAGGGCAGATGG - Intronic
1137930748 16:52585002-52585024 AAGAGGACAAGTAGGGCAGCAGG - Intergenic
1137968303 16:52958729-52958751 GACAGAAAAAGCAGGGCAGAGGG + Intergenic
1137990638 16:53151215-53151237 GAGAGGAAAGGGAGGGGAGGGGG - Intronic
1137995742 16:53209714-53209736 AAGAGGAAAAGAAAGGTAGAAGG + Exonic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138293862 16:55870330-55870352 AAGAGGAAGAGGAAGGGAGAAGG + Intronic
1138294786 16:55876861-55876883 TAGAGGAGGAGGAAGGCAGGGGG + Intronic
1138547955 16:57730440-57730462 CAGAGGAATAGATGGGCAGATGG + Intronic
1138729044 16:59174641-59174663 TAGACAAAAAGGAGAGAAGAGGG - Intergenic
1139053834 16:63157463-63157485 CAGAGGCCTAGGAGGGCAGATGG + Intergenic
1139137473 16:64222368-64222390 GAGAGGAAAAGAAGTGGAGATGG + Intergenic
1139339239 16:66257148-66257170 TAAAGCAAAAGGAGGGCAAGAGG - Intergenic
1139341029 16:66267931-66267953 AAAAGGAAAAGGAGGGAAGGAGG + Intergenic
1139962132 16:70724130-70724152 TAGAGGAAATGCTGGCCAGAGGG - Intronic
1140003274 16:71047994-71048016 CAGAGGATAAGAAGGGTAGAGGG - Intronic
1140078762 16:71724668-71724690 TAGATCTAAAGAAGGGCAGAGGG - Exonic
1140199975 16:72887181-72887203 GAGAGGAGCAGGTGGGCAGAGGG + Intronic
1140219969 16:73036609-73036631 TAGAGGAAGAGGAGGGGAGAGGG + Intronic
1141045838 16:80715570-80715592 TGGAGGAAAGGGAGGCCGGAGGG - Intronic
1141080565 16:81047992-81048014 TGGGGGAAAAGGAAGGCAGAAGG + Intergenic
1141157383 16:81606769-81606791 CACCGGAAAAGGAGGGCACAGGG + Intronic
1141417348 16:83886207-83886229 TAAAGGGAAAGGAGGGGACACGG + Intergenic
1141572508 16:84942380-84942402 CAGACAAAAAGGAGGGCAGAGGG - Intergenic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1141867329 16:86759776-86759798 TAGTGCAAAAGGACGGGAGATGG + Intergenic
1142198787 16:88751213-88751235 TAGAGGAGGCGCAGGGCAGAGGG + Intronic
1203095509 16_KI270728v1_random:1252466-1252488 CAGAGGAAAAGCTGGGTAGAGGG - Intergenic
1142902147 17:3018707-3018729 TTGAGGAAAAGGAGGCCCGCTGG + Intronic
1143165884 17:4897122-4897144 GAGAGGGAAAGAAGGGAAGAAGG - Intronic
1143306752 17:5953573-5953595 TAGAGTAAGAGGAGGGTAAAAGG + Intronic
1143388119 17:6543977-6543999 TCGGGGCAAAGGAGGGCACATGG + Intronic
1143391299 17:6560838-6560860 AGGAGGAAAAGGAGGGGAGGAGG - Intergenic
1143391422 17:6561262-6561284 AAGAGGAGGAGGAGGGGAGAAGG - Intergenic
1143517793 17:7428752-7428774 TCGAGGAAGAGGAGGGCCCAGGG - Intergenic
1143965817 17:10755942-10755964 GAAAGGAAAAGGAGGGGGGAGGG - Intergenic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144244973 17:13353616-13353638 TGGAGGAAGAGCAGGGCAGGAGG + Intergenic
1144342496 17:14321490-14321512 AAGGGAAGAAGGAGGGCAGAGGG + Intronic
1144839331 17:18175943-18175965 GAGAGGACAGTGAGGGCAGAGGG - Intronic
1145123038 17:20277920-20277942 GAGAGGAGAAGGTGGACAGATGG - Intronic
1145123309 17:20279853-20279875 GAGAGGAGAAGGTGGACAGATGG + Intronic
1145251661 17:21300057-21300079 TAGATGAACAGGACAGCAGATGG - Intronic
1145828626 17:27897187-27897209 TAAAGGAGGAGCAGGGCAGAAGG - Intergenic
1146349977 17:32085040-32085062 TGGAGGAAAAGGCGGGGAGGAGG - Intergenic
1146547698 17:33753300-33753322 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1146667639 17:34715606-34715628 TGGAGGTGGAGGAGGGCAGAGGG - Intergenic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147003447 17:37382311-37382333 GAAAAGGAAAGGAGGGCAGAAGG - Intronic
1147579978 17:41622728-41622750 TAGAAGAGAAGGAGGGGAGGCGG - Intronic
1148180689 17:45602452-45602474 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148180704 17:45602548-45602570 AAGAAGAAAAGGAGGGAGGAAGG - Intergenic
1148268199 17:46243378-46243400 AAGAAGAAAAGGAGGGAGGAAGG + Intergenic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149013826 17:51885480-51885502 TAGAGGAAAAGAGGAGTAGATGG - Intronic
1149607508 17:57935581-57935603 GGGAGGAAAGGGAGGGCAGCGGG - Intronic
1150255257 17:63739564-63739586 TAATGGAAGGGGAGGGCAGATGG + Intronic
1150793051 17:68215021-68215043 GAGAGGCCGAGGAGGGCAGATGG - Intergenic
1150878311 17:68994489-68994511 TCGCTGAAAAGTAGGGCAGAGGG + Intronic
1151143068 17:72013974-72013996 TAGAGGAACTGGAGGGTGGAGGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1153080192 18:1214113-1214135 AGGAGGAAAAGGAGGGCATAGGG + Intergenic
1153406033 18:4740581-4740603 TAGAGGAGAAGAAAGGGAGAAGG - Intergenic
1154092405 18:11378105-11378127 AAGAGGAGAAGGAGGGCACCAGG + Intergenic
1154939141 18:21093582-21093604 TGCAGGAAAATGAGGGCAGTAGG - Intronic
1155656068 18:28194646-28194668 TAGGGGAAAAGAAGGGAACAGGG - Intergenic
1156252705 18:35366191-35366213 TAGAGGGAAAGCAGGCCAGATGG - Intergenic
1156495898 18:37524974-37524996 GAGAAGAAAGGGAGGGCCGAGGG - Intronic
1156660877 18:39345118-39345140 GAGAGGAAAGGGAGAGAAGAGGG + Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1156827631 18:41450955-41450977 AGGAGGAAAAAGAGGGGAGAAGG - Intergenic
1157315951 18:46589799-46589821 TAAAGTAAAAGGAGGTCATATGG + Intronic
1157680130 18:49598559-49598581 AAGAGGAGAAGGAGAGGAGAAGG - Exonic
1157815712 18:50728282-50728304 AAGAGCAAATGAAGGGCAGATGG - Intronic
1157869992 18:51221178-51221200 CAGAGGAAAAGGAGGGGAAGTGG + Intergenic
1158307668 18:56124726-56124748 TAGAGGGGAAGGGGGGCACATGG + Intergenic
1158339916 18:56454808-56454830 GAGAGGGAAAGGAAGGAAGAAGG + Intergenic
1158371367 18:56809077-56809099 AGGAGGAAAATGGGGGCAGAGGG - Intronic
1158605297 18:58890708-58890730 TGGAGAAAAAGAAGGGGAGAGGG - Intronic
1158618906 18:59013215-59013237 TAGGGAAGAAAGAGGGCAGAAGG - Intergenic
1159015566 18:63099424-63099446 AGGAGGTGAAGGAGGGCAGAAGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159306278 18:66647035-66647057 TACAAGAAAAGGAGAGCAGAGGG - Intergenic
1159566288 18:70054591-70054613 GAGAGGCCAAGGTGGGCAGATGG + Intronic
1159723764 18:71927457-71927479 TAGAGAAAAAAGAGGTAAGAAGG - Intergenic
1159879953 18:73849523-73849545 TAGAGGGAAAGAAGGGGAGAGGG + Intergenic
1159918838 18:74209403-74209425 TAGAGCAGAAGGAGGGAAGGAGG - Intergenic
1160469656 18:79117592-79117614 TAGTTGGAAAGGAGGTCAGAGGG + Intronic
1161392651 19:4029198-4029220 TGGAGGATACGGATGGCAGAGGG + Intronic
1162892287 19:13742570-13742592 TACAGGGAAAGGAAGGCATAGGG - Intronic
1162982308 19:14247963-14247985 TGGAGGAAAAGGCGGGGAGGAGG + Intergenic
1163042072 19:14610036-14610058 TGGAGGAAAAAGTGGGCAGAGGG - Intronic
1163284262 19:16336604-16336626 TAAAGAAAAAGGAGGGGGGATGG - Intergenic
1164025692 19:21350120-21350142 TTGAGGAGAAGGATGGGAGAGGG - Intergenic
1164146460 19:22515465-22515487 GAGAGGAAAAGGTTGCCAGAAGG + Intronic
1164159907 19:22619669-22619691 AAGAGGAAAAGGCTGCCAGAAGG - Intergenic
1164249776 19:23466589-23466611 GAGAGGAGAAGGAGAGTAGAAGG - Intergenic
1164249935 19:23467548-23467570 AAGAGGAAAAGAAGAGGAGAAGG - Intergenic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164250268 19:23469582-23469604 AAGAGAAAAAGGAGGAGAGAAGG - Intergenic
1164292270 19:23879370-23879392 GAGAGAAAAAGGAGGAGAGAAGG + Intergenic
1164292730 19:23882012-23882034 AGGAGGAAGAGGAGAGCAGAAGG + Intergenic
1164324418 19:24179438-24179460 GAGAGAAAAAGGAGGGAAGGAGG + Intergenic
1164324595 19:24180465-24180487 GAGAGGAAAAGGAGTGGAGGAGG + Intergenic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1164441719 19:28284559-28284581 TATAGGAGAAGGAGGGTATAGGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164463519 19:28468416-28468438 GAGGGGAGAAGGAGGGGAGAAGG + Intergenic
1164617257 19:29674588-29674610 ACGAGGACAAGGAGGGCAGCAGG + Exonic
1164680467 19:30130948-30130970 GGGAGGAAAAGGAGGAGAGAGGG - Intergenic
1164784564 19:30919800-30919822 AAGAAGAAAAGGAGGAGAGAAGG + Intergenic
1164834517 19:31349138-31349160 AAGAGGAGGAGGAGAGCAGAAGG + Intronic
1165020868 19:32922941-32922963 TAGAGGATGAGGAGTGCAGAAGG + Intronic
1165148671 19:33748645-33748667 TAGAGGACAAGGTGAGCAGCCGG - Intronic
1165151940 19:33766197-33766219 TAGAGGTGGAGGAGGGGAGAAGG - Intronic
1165324435 19:35106103-35106125 TAAAGGCAAAGGAGGGGAGGTGG - Intergenic
1165327194 19:35121045-35121067 AAGAGGGGAAGGAGGGGAGATGG - Intronic
1166160226 19:40947218-40947240 AGGAGGAAAAGGAAGGCGGAGGG + Intergenic
1166392851 19:42419547-42419569 TAGGGGAGAGGTAGGGCAGAGGG + Intronic
1166402693 19:42495408-42495430 GAGAGGAAAGGGAAGGGAGAGGG + Intergenic
1166443623 19:42838779-42838801 TAGAGGTAAAGGAAGTGAGAAGG + Intronic
1166463317 19:43009443-43009465 TAGAGGTAAAGGAAGTGAGAAGG + Intronic
1166480590 19:43169539-43169561 TAGAGGTAAAGGAAGTGAGAAGG + Intronic
1167130542 19:47582326-47582348 GAGAGGAAGAGGAGGGAAGGAGG - Intergenic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167701171 19:51046956-51046978 AACAGGAAGAGGAGGGCAGGTGG + Intergenic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168526087 19:57089878-57089900 TGGAGGACACGGAGGGAAGACGG + Intergenic
1168540029 19:57202502-57202524 TAGAGCGAAAGGAGGGCAGGAGG - Intronic
1202672058 1_KI270709v1_random:64181-64203 AAGAGGAAAAGAAAGGAAGAAGG + Intergenic
925678026 2:6386737-6386759 TTGAGAAAAAGGAGTTCAGAAGG - Intergenic
925811701 2:7707787-7707809 TTGAGGAGAAGGAGAGTAGAGGG - Intergenic
925834411 2:7930166-7930188 TAGAGGGAAGGAAGGGCTGAGGG + Intergenic
925974489 2:9132163-9132185 TGGAGGCCAAGGAGGGAAGATGG + Intergenic
926087332 2:10028672-10028694 GAGGGGAAAGGGAGGGGAGAAGG - Intergenic
926341489 2:11908364-11908386 AAGAGGAAACTGAGGGTAGAGGG + Intergenic
926353879 2:12022150-12022172 TAGAAGCAAATGAGGGCACAGGG - Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926717686 2:15938282-15938304 TAGCAGAAAAGGGGGACAGAGGG - Intergenic
926938441 2:18110710-18110732 TCAAGGAAAAGGAAAGCAGAAGG - Intronic
927088497 2:19692942-19692964 TTGAGTAAATGGATGGCAGATGG - Intergenic
927300283 2:21504375-21504397 TAGAGGAAAAATGAGGCAGAAGG - Intergenic
927453852 2:23232393-23232415 TAGATGACAAGCAGGGGAGATGG - Intergenic
927868647 2:26609285-26609307 TAGAGGCTGAGGAGGGCAGGGGG + Intronic
928257236 2:29733357-29733379 TAAGGGAAAAGGAGGCCAGATGG + Intronic
928264077 2:29795970-29795992 GGAAGGAAAAGAAGGGCAGAAGG - Intronic
928929192 2:36606354-36606376 TAAAGGAAAAGGCGGGGATAAGG - Intronic
928958675 2:36898923-36898945 GAGAGGAAAAGGGGGAAAGAGGG + Intronic
929258922 2:39843272-39843294 TAGAAGAACAGGATGCCAGAGGG - Intergenic
930204218 2:48572213-48572235 GGGAGGAAGAGGAGGGCAGTGGG + Intronic
930589830 2:53314001-53314023 AAGAAGAAAAGGAGGGAAGGAGG + Intergenic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
930725433 2:54677106-54677128 AGGAGGAAAGGTAGGGCAGAAGG + Intergenic
931199266 2:60081271-60081293 TTGGGCAAAAGAAGGGCAGATGG - Intergenic
931434527 2:62235350-62235372 TCCAGAAAAAGGAGGACAGAAGG - Intergenic
932196554 2:69788857-69788879 AAGAGGGAAAGAAGGGAAGAAGG + Intronic
932435173 2:71699196-71699218 TGGAGGAGAAGGAGGGGTGAGGG - Intergenic
932559064 2:72851307-72851329 TAGAGGACCAGGCTGGCAGAGGG + Intergenic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933929452 2:87134001-87134023 TAAAGAAAAAGAAGGGCAGGAGG - Intergenic
934000782 2:87709793-87709815 TAAAGAAAAAGAAGGGCAGGGGG - Intergenic
934249410 2:90336350-90336372 AGGAAGAAAAGGAGGGCAGGAGG - Intergenic
934260169 2:91467116-91467138 AGGAAGAAAAGGAGGGCAGGAGG + Intergenic
934604862 2:95687007-95687029 TAGAGGATGAGGAGGGGAGTGGG - Intergenic
934663325 2:96154511-96154533 TAGAGGAAAAGGAGAGAGAAGGG - Intergenic
934796876 2:97108895-97108917 TAGAGGGAAAGGGCGGCTGAGGG + Intergenic
934903103 2:98176534-98176556 TAGCTGAAAAGGAAGGCAGAAGG - Intronic
934932863 2:98442490-98442512 AAGAGGAAAAAGTGGGCAGGAGG + Intergenic
936363486 2:111829384-111829406 TAAAGAAAAAGAAGGGCAGGGGG + Intronic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
936986806 2:118319300-118319322 GGCAGGAAAGGGAGGGCAGAGGG - Intergenic
937266046 2:120615219-120615241 TGCAGGAAGAGGAGGGCAGGGGG - Intergenic
937279300 2:120706283-120706305 TAAAGAAAAAGGGGGGCAGCTGG - Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937683747 2:124672252-124672274 TAAAGTAAAATGAGGGCAAATGG - Intronic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938673396 2:133605871-133605893 AAGAGGAAAAGGGGGGCAGGAGG + Intergenic
938713813 2:134000457-134000479 CAGGGGAAAAGGAAGTCAGATGG + Intergenic
938845728 2:135206765-135206787 GAGAGGAAAAGAAGGATAGAAGG + Intronic
938906190 2:135838170-135838192 TATAGGAAGAGGAGGGGGGAGGG - Intergenic
939674570 2:145056083-145056105 TTGAGGCTAAGGTGGGCAGATGG + Intergenic
940268912 2:151870352-151870374 GAGAGGAAAGAAAGGGCAGAGGG + Intronic
940279363 2:151973620-151973642 AGGAGGAAGAGGAGGGGAGAGGG + Intronic
940432199 2:153605978-153606000 GTGAGGAGAAGGAGGCCAGAAGG + Intergenic
940526574 2:154823299-154823321 TAGAGAATTAGAAGGGCAGAAGG + Intronic
940825915 2:158412129-158412151 TAGTGGAAAAGGAAAGCAGGAGG - Intronic
941279759 2:163535318-163535340 TAAAGGAGAAATAGGGCAGATGG - Intergenic
941285290 2:163604829-163604851 GAGAGGAAGAGGAGAGGAGAGGG + Exonic
941788718 2:169527087-169527109 TAGAGGAAGAGGGGGCCACAGGG + Intergenic
942543959 2:177043588-177043610 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
942650642 2:178163704-178163726 TAGAGGGCCAGGAGGCCAGAAGG + Intergenic
942818390 2:180080480-180080502 AAGGGAAAAAGGAGGGGAGAGGG - Intergenic
943495003 2:188609432-188609454 TGGAGCAAAAGGAAGACAGAGGG + Intergenic
943574565 2:189615919-189615941 ATGAGGAAAAGGAGCTCAGAGGG - Intergenic
943600901 2:189919855-189919877 TAGAGGAAGAGGATGGAGGAGGG - Intronic
943626364 2:190205591-190205613 TAAAGGCAGGGGAGGGCAGAGGG + Intronic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
944145521 2:196503551-196503573 GAGGGGAACAGGAGGGCAGAAGG - Intronic
944328300 2:198433364-198433386 CAGAAGAAAAGAAGGACAGAAGG - Intronic
944406750 2:199393253-199393275 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
944884350 2:204047606-204047628 AGGAGGAAAAGGTGAGCAGAAGG - Intergenic
946912225 2:224475664-224475686 TGGAAGAAAAGAAGGGCAAAGGG - Intronic
946986626 2:225280978-225281000 TAGAGGAAAAGGACCACAGAAGG - Intergenic
947154090 2:227143889-227143911 TGTAGGAAAAGGAGAACAGAAGG + Intronic
947511003 2:230754367-230754389 GAGGGGAAGAGGAAGGCAGAAGG - Intronic
947836127 2:233176847-233176869 GAGATGAAAAGGTGGACAGATGG + Intronic
948056003 2:235009798-235009820 TGGAGAAAAAGGAAGGTAGAGGG - Intronic
948814280 2:240502034-240502056 TTCAGGAAAAGGTGGGCAGATGG + Intronic
1168755781 20:316527-316549 TAGAGGGAAGGCAGAGCAGATGG + Intergenic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169900904 20:10550786-10550808 AACAGGGAAAGGAGTGCAGAAGG - Intronic
1170197187 20:13701481-13701503 TAGAGTAAAATGATGGAAGAAGG + Intergenic
1170198932 20:13721399-13721421 CAGAGGCAAAGCAGGACAGAAGG + Intronic
1170593206 20:17786837-17786859 TAGAGGAGAAGGGGAGGAGAGGG - Intergenic
1170721427 20:18883222-18883244 GAGAGGAAAAGGATGGTTGAGGG - Intergenic
1170843085 20:19939748-19939770 TAGAAGAAAAGGAGGGCTCAAGG - Intronic
1170916415 20:20631003-20631025 TAGATGAAAGGGAGGGGACATGG - Intronic
1170936252 20:20812419-20812441 TAGAGGAAAAGGCAGGCTGGCGG - Intergenic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1171233820 20:23508800-23508822 TAGGAGCAGAGGAGGGCAGAAGG - Intergenic
1171332800 20:24356393-24356415 GAGAGGAGAAAGAGGACAGAGGG + Intergenic
1171433951 20:25104762-25104784 TGGAGGGGAAGGAGGGCAGCAGG - Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1171778034 20:29389059-29389081 GAGAGAAGGAGGAGGGCAGAGGG - Intergenic
1171941156 20:31331105-31331127 GAGAGAAGAAGGAGAGCAGAAGG + Intergenic
1171941157 20:31331116-31331138 GAGAGCAGAAGGAGAGCAGAAGG + Intergenic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172737700 20:37140440-37140462 GGGAGGCAAAGGTGGGCAGATGG - Intronic
1172837887 20:37884795-37884817 TAGATGGAAATGCGGGCAGAAGG + Intergenic
1172870899 20:38134981-38135003 GAGAGGAAGGGGAGGACAGAAGG - Intronic
1172988953 20:39017720-39017742 TAGAGGGCAAGAAGGGCAGGTGG + Intronic
1173066678 20:39719868-39719890 CAGTGGAAAATCAGGGCAGAAGG + Intergenic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173833707 20:46111101-46111123 TTGAGGGGAAGGAGGGCAGGAGG + Intergenic
1174264744 20:49323259-49323281 TAGACAATAAGGAGGGCAGATGG + Intergenic
1174744469 20:53047945-53047967 CAGTGGAAACGGAGGTCAGAAGG + Intronic
1175119937 20:56709667-56709689 TCTAAGAAGAGGAGGGCAGAAGG - Intergenic
1176900711 21:14438472-14438494 CAGAGGAACAGCAGGACAGACGG + Intergenic
1177692050 21:24523121-24523143 AAGAGTGAAAGGAGGGCAAAGGG + Intergenic
1177722881 21:24929648-24929670 TATAGTAATAGGAGGGGAGAAGG - Intergenic
1178431570 21:32522513-32522535 GAGAGAAAGAGGAGGGCAGGAGG - Intergenic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179193788 21:39145666-39145688 GAGAAGGAAAGGAGGGCAGTAGG + Intergenic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1180765124 22:18341688-18341710 TAGCCAAAAAGGAGGGCAGAGGG - Intergenic
1180813905 22:18777996-18778018 TAGCCAAAAAGGAGGGCAGAGGG + Intergenic
1181033728 22:20160167-20160189 TAGAGGAACTGGAGGGCTGGAGG - Intergenic
1181200090 22:21212331-21212353 TAGCCAAAAAGGAGGGCAGAGGG + Intronic
1181270635 22:21656751-21656773 TGGAGGACAAGGAGGGGACAAGG + Intronic
1181436285 22:22913101-22913123 CAGATGAGAAGGAAGGCAGATGG + Intergenic
1181701645 22:24624628-24624650 TAGCCAAAAAGGAGGGCAGAGGG - Intronic
1182415853 22:30221108-30221130 GAGGGCAAAGGGAGGGCAGACGG + Intergenic
1182529500 22:30944453-30944475 GAGAGGAGAAGGGGGCCAGAGGG - Intronic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183915414 22:41114414-41114436 GTGAGGCCAAGGAGGGCAGACGG - Intronic
1183966110 22:41443958-41443980 AAGAGGAAAAGGAGGGATAATGG + Intronic
1184103538 22:42354229-42354251 GAGAGGAAATGGGGGCCAGATGG - Intergenic
1184319586 22:43730212-43730234 GAGAGGAAAAGGAGGGCAGGAGG + Intronic
1184487956 22:44792514-44792536 TGGAGGAGCAGGAGGGCAGGGGG - Intronic
1185069203 22:48647048-48647070 GAGAGGAGAAGGACAGCAGAGGG + Intronic
1185229352 22:49671166-49671188 CAGATGAAAAGGAAGGCAGGTGG + Intergenic
1203226746 22_KI270731v1_random:82593-82615 TAGCCAAAAAGGAGGGCAGAGGG - Intergenic
1203264004 22_KI270734v1_random:3683-3705 TAGCCAAAAAGGAGGGCAGAGGG + Intergenic
949310446 3:2691397-2691419 AAGAGGAAGAGGAGGGTAGAGGG + Intronic
950465796 3:13153079-13153101 GAGGGGAGAAGGAGGGGAGAGGG - Intergenic
950465803 3:13153097-13153119 GAGAGGAGAGGGAGGGGAGAGGG - Intergenic
950865963 3:16189243-16189265 TACAGGCAAAGGAGGCCAGGTGG - Intronic
951046182 3:18041069-18041091 GAGAGGACAAGGAGGGAAGAGGG - Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951623161 3:24628948-24628970 GAGAGGAAGATGAGGGTAGAAGG - Intergenic
951782228 3:26376690-26376712 TGGATGAAAAGGAAGGGAGAAGG + Intergenic
951914291 3:27783172-27783194 AAGAAGGAAAGGAGGGGAGAAGG + Intergenic
952240951 3:31531597-31531619 TAGCGGACAAGGAGGGAAGTGGG + Intergenic
952357801 3:32600861-32600883 AAGAGGAAAGATAGGGCAGAGGG + Intergenic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
952470648 3:33647664-33647686 TACAAAAACAGGAGGGCAGATGG + Intronic
952877597 3:37959962-37959984 GAGAGGCCGAGGAGGGCAGATGG + Intronic
953917348 3:46928782-46928804 TAGAGGAAAATGATCTCAGACGG + Intronic
954427886 3:50453210-50453232 TGGAGGAAGAGGAGAGCTGAGGG - Intronic
954722605 3:52578198-52578220 TAGAGGAGAACAAGGGGAGAAGG - Intronic
954812555 3:53256993-53257015 GGGAGGCAGAGGAGGGCAGATGG - Intergenic
954852254 3:53613338-53613360 TACAGGAAGAAGAGGGAAGAGGG - Intronic
955075776 3:55611682-55611704 TGGAGAGAAAGGAGGGCAGTTGG - Intronic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955848405 3:63193172-63193194 TAGAGGAAATGGAGGAAGGAGGG - Intergenic
956313959 3:67913828-67913850 AGGAGGAAAAGGAGGGGAAAAGG - Intergenic
956420166 3:69079812-69079834 TGGAGGAAGAGGAGTGCACAAGG + Intronic
956504046 3:69918653-69918675 ATGAGGAAACTGAGGGCAGAGGG - Intronic
956915176 3:73863167-73863189 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
956957791 3:74360853-74360875 GAGAGGAAGAGGGAGGCAGAAGG - Intronic
957266758 3:77976893-77976915 TGGAGGAAAGGGAGAGGAGAAGG + Intergenic
957472183 3:80672551-80672573 TAGAGAAAAAGGAGAGTAGGAGG + Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958579095 3:95992864-95992886 TAGAGAAAAAGAAGGGAACATGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959251939 3:103959547-103959569 TAGAGGGAAAGTTGGCCAGATGG + Intergenic
959349893 3:105249055-105249077 AGGAGCAAAAGGAGGGCAGGGGG - Intergenic
959462071 3:106639520-106639542 TAGAGGCTAAGAAGGGTAGAGGG - Intergenic
959519336 3:107307455-107307477 CTGAGAAACAGGAGGGCAGAAGG + Intergenic
960507312 3:118509461-118509483 TAGAGGAAAAGGCAGGGATAGGG - Intergenic
960796808 3:121496138-121496160 TTGAGGAGAAGGACGGAAGATGG - Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961203014 3:125059223-125059245 TACAGGCAAAGAAGGGGAGAAGG + Intergenic
961359865 3:126360367-126360389 TAGAGGAAGAGGTGGTGAGAAGG - Intergenic
961564300 3:127752688-127752710 TAAAGGAAAACGGTGGCAGATGG + Intronic
962079668 3:132124505-132124527 TAGAAGGAAAGGAGTGAAGAAGG - Intronic
962311886 3:134332594-134332616 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
962311894 3:134332620-134332642 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
962311902 3:134332646-134332668 TAGGGGGAGAGCAGGGCAGAAGG - Intergenic
963468036 3:145707810-145707832 TAAAGGTAAAGGTGGGAAGAAGG - Intergenic
963836224 3:150060543-150060565 TAAATGAGAAGGAGGGCAGGAGG + Intergenic
963896743 3:150694597-150694619 AAGGGGAAAAGCAGGTCAGAAGG - Intronic
964315860 3:155443652-155443674 TAGAGGAGAGGAAGGGCAGAGGG + Intronic
964627574 3:158773842-158773864 AAGAGGAAAAGGAAGACAGCAGG - Intronic
964738340 3:159939761-159939783 AAGAGGAAAATGAGGACAGGTGG - Intergenic
965077713 3:164001251-164001273 AAGAAGGAAAGGAGGTCAGAAGG + Intergenic
965490704 3:169332230-169332252 TCAGGGAAAAGGAGGGAAGAAGG + Intronic
965628795 3:170709333-170709355 TAGAGGGGAAGGAGCCCAGATGG - Intronic
966244774 3:177794977-177794999 TAGAGGAAAAGGAGAAGAGAAGG - Intergenic
966300746 3:178476869-178476891 TAGAGGAGAAGGAGAGTGGAAGG + Intronic
967085185 3:186088491-186088513 TAGAGGGAAAGGAAGTGAGATGG - Intronic
967464712 3:189790859-189790881 AAGAGGAAGAGTAGAGCAGAGGG + Intronic
967568859 3:191003685-191003707 TAAAAGAAAAGTAGTGCAGAAGG - Intergenic
967625722 3:191681526-191681548 GAAAGGCAATGGAGGGCAGATGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968735390 4:2292402-2292424 GACAGGAATAGGAGGGCACAAGG + Intronic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969050334 4:4368558-4368580 GAAAGGAAAAGGTGGGCAGCAGG - Intronic
969253544 4:5987594-5987616 AAGAGGGAAAGGAAGGCAGGAGG + Intronic
969393776 4:6907936-6907958 GTGAGGAAAAGGCAGGCAGAGGG + Intergenic
969465848 4:7355947-7355969 TGGAAGGAAGGGAGGGCAGAGGG - Intronic
969624437 4:8295163-8295185 TAGAGGGACAGGTGGGTAGACGG - Intronic
969928960 4:10611771-10611793 TGGAGGAAAGGAAGGGGAGAGGG - Intronic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970159349 4:13173329-13173351 GGGAGGAAACGGAGGGAAGAAGG + Intergenic
970689544 4:18606836-18606858 TAAAGGAAAATGAGGGAATAGGG + Intergenic
971300958 4:25442170-25442192 TAGAGAGAAAGGAAGGAAGAGGG + Intergenic
971449609 4:26787746-26787768 TAGAGGAAAGGGGGTCCAGAGGG - Intergenic
971764211 4:30808472-30808494 AAGAGGGAAAGGATGCCAGATGG - Intronic
973043878 4:45510664-45510686 TTGAGGGAAAGGATAGCAGAAGG - Intergenic
973185722 4:47325555-47325577 AAGAGGAAAATGATGACAGATGG - Intronic
973603580 4:52565143-52565165 TAATGGAAAAGGAGAGCATAGGG + Intergenic
975052142 4:69879030-69879052 TAGAGAAAAAGAAAGGCAGATGG - Intergenic
975177348 4:71303082-71303104 CAGAGGAAAATGAGGTCTGATGG - Intronic
975604469 4:76140195-76140217 AAGAGGAAAAGGTGGATAGAGGG + Intronic
976074510 4:81282204-81282226 TAGAGGTAAATGAGGTCATAGGG + Intergenic
976365163 4:84225097-84225119 AAGAAGAAAAGAAGGGAAGAAGG + Intergenic
976429751 4:84948684-84948706 AACAGGAAAAGGACAGCAGAAGG - Intronic
976575348 4:86663527-86663549 CAGAGGAAAAGGGTGGGAGAAGG + Intronic
976754325 4:88482365-88482387 GGGAGGAAAAGAAGAGCAGAGGG - Intronic
976838103 4:89398989-89399011 TAGAGGAAAAGGAATGCAGGAGG + Intergenic
977229180 4:94431585-94431607 GAGAGGCTAAGGTGGGCAGATGG - Intergenic
977731878 4:100363510-100363532 TAGAGGAAGAGGAGTTGAGAAGG - Intergenic
979292383 4:118992065-118992087 TGGAGGAAAAAGAGGGCGGCAGG + Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
980256729 4:130390517-130390539 AAGAGGCAAAGGAGGTCAGTGGG - Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
981099011 4:140810743-140810765 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981099019 4:140810767-140810789 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981706381 4:147663603-147663625 GGGAGGCAAAGGTGGGCAGATGG - Intronic
981739620 4:147988470-147988492 TAGAGGAAAAGGCTGTCAGATGG - Intronic
981841287 4:149115526-149115548 AAGGGGAAGAGGAGAGCAGATGG + Intergenic
982311805 4:153993887-153993909 TAGGGGAAAAGGTGGGAAGGGGG - Intergenic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982601533 4:157457115-157457137 AAGAGAAAAAGGAAGGGAGAAGG - Intergenic
982848727 4:160283023-160283045 CAGAGGAAAAGAAGAGCAGGAGG - Intergenic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983595130 4:169457700-169457722 GAGGGGAGAAGGAGGGGAGAGGG + Intronic
984084137 4:175287256-175287278 TAAGGGATAAAGAGGGCAGAAGG + Intergenic
984812593 4:183807830-183807852 TAGAGGAAGAGGAGGTGTGAGGG + Intergenic
984831934 4:183983967-183983989 TAGAGGAAGAGAAGGCAAGAGGG - Intronic
984859888 4:184228575-184228597 TATAAGAAGAGAAGGGCAGAGGG - Intergenic
984935180 4:184883474-184883496 TAAAGGAACAGGAGGGAGGAGGG + Intergenic
985034368 4:185823171-185823193 AAGGGGAAAAGGAGGCCGGAGGG - Intronic
985813362 5:2107604-2107626 TAGATGAATAGAAGGACAGATGG + Intergenic
985813381 5:2107837-2107859 TAGATGAATAGAAGGACAGATGG + Intergenic
986005157 5:3661246-3661268 TAGAAGGAAAGAGGGGCAGAAGG + Intergenic
986223012 5:5787411-5787433 AAAATGAAAAGGAGAGCAGAGGG - Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
987367726 5:17164157-17164179 TGGAGGAAAAAGAGGAGAGAAGG - Intronic
987753044 5:22066308-22066330 TAGAGGAAAAGATGGGAAGGGGG - Intronic
988053191 5:26056758-26056780 TAGATGAAAATGATGGCAGGAGG + Intergenic
988072360 5:26308626-26308648 TAGAGGTAAGGAAAGGCAGAGGG + Intergenic
988429200 5:31100013-31100035 TAGAGGAAAGGGATTCCAGAGGG - Intergenic
988536072 5:32070296-32070318 CAGAGGAAAAGGAAAGCATAGGG + Intronic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989107771 5:37879675-37879697 AAGAGGTAAAGGAGGGGTGATGG + Intergenic
990046451 5:51438164-51438186 GAGAGCAAGAGGTGGGCAGATGG + Intergenic
990223436 5:53622134-53622156 TAAAGGAAAAGGATACCAGATGG - Intronic
990759546 5:59113077-59113099 AAGAGAACAAGGAGGGAAGAAGG - Intronic
991628811 5:68632956-68632978 GAGAGGGAAAGAAGGACAGAAGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991939153 5:71833409-71833431 GAGAGGAGAGGGTGGGCAGATGG - Intergenic
991968459 5:72114814-72114836 GAGAGGAACAGGAGGGCAAGAGG - Intronic
992188422 5:74266349-74266371 GAGTGGAAAAGAAGGCCAGAAGG + Intergenic
992370404 5:76137859-76137881 AAGAGGAAAGGGATGCCAGAAGG - Intronic
992763585 5:79973761-79973783 TAGAGAAAGATGAGGTCAGAGGG - Intergenic
993379595 5:87191370-87191392 AAGAGGAAAAGCAGGGAAGGAGG + Intergenic
993920583 5:93795586-93795608 TAGAGGATTAAGATGGCAGATGG - Intronic
993925365 5:93858867-93858889 AAGAGGAAAAAGAGGAGAGAGGG + Intronic
995402340 5:111757275-111757297 TGGAGGAAGAGGAGGGAGGAGGG + Intronic
995838535 5:116421802-116421824 TAGAGCAGAAGGAGGGAAGGGGG + Intergenic
995948397 5:117679558-117679580 GAGAGGAACAGAATGGCAGAGGG + Intergenic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
996243434 5:121229874-121229896 TAGAGGCAAAGCATGGAAGAGGG - Intergenic
996772303 5:127098284-127098306 TAGAGGTAGAGGAGGGGAGGTGG + Intergenic
998227196 5:140336156-140336178 TAGAGGAGAAGGATGGAGGATGG - Intronic
998469949 5:142375794-142375816 CAGAGGAGAAGCAGGGCAAAGGG - Intergenic
998500636 5:142629552-142629574 TAGAGGACAAGGAAGTCAGGAGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
999546440 5:152634051-152634073 TGTAGGGAACGGAGGGCAGAGGG - Intergenic
999883051 5:155888750-155888772 TAGAGGAGAAGGGTGGGAGAAGG + Intronic
1000109315 5:158092848-158092870 AAGAGGAAAAGTAGGCAAGAGGG - Intergenic
1000731416 5:164838734-164838756 GAGAGGAAAATGAAGGCGGAAGG - Intergenic
1001855568 5:175007605-175007627 AGGAAGAAAAGGAGGGAAGAAGG - Intergenic
1001905427 5:175468435-175468457 TGAAGGAAGAGGAGAGCAGAGGG - Intergenic
1002177994 5:177413192-177413214 GAGAGGAAGAGGAAGGGAGATGG - Intronic
1003268915 6:4590337-4590359 TAGAGATAAAGGAGGGCTTAGGG - Intergenic
1003348662 6:5294950-5294972 TACAGTCAAAGGAGGGCAGGAGG + Intronic
1003582849 6:7358169-7358191 TGGAGGTCAAGGAAGGCAGATGG - Intronic
1004099572 6:12594932-12594954 GAGAGGAAAAGAAGGAGAGAAGG + Intergenic
1004286157 6:14322745-14322767 TTGAGGGACAGGAGAGCAGAGGG + Intergenic
1004383582 6:15153023-15153045 TTCAGAGAAAGGAGGGCAGAGGG - Intergenic
1004627782 6:17393464-17393486 TGGAGGAAAGGAGGGGCAGATGG - Exonic
1005372914 6:25153838-25153860 GAGAAGAAAGGGAGGTCAGATGG - Intergenic
1005877913 6:30028127-30028149 TCGGGGAAAGGGAGGGAAGAAGG + Intergenic
1005959895 6:30687164-30687186 GAGAGGAAGAGGAGGAGAGAGGG + Exonic
1006441177 6:34054617-34054639 GAGAGGGACAGGAGGGGAGAAGG - Intronic
1006446995 6:34085162-34085184 TATATGCAAAGGAGGGCAGGGGG + Intronic
1006574930 6:35038044-35038066 GAGGGGAAAAGGAAAGCAGAGGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006860362 6:37168346-37168368 GAAAGGAAAGGGAGGGTAGAAGG + Intergenic
1007248300 6:40478124-40478146 GAGAGGAAGAGGATGGCAGCAGG - Intronic
1007248562 6:40480169-40480191 ATGAGGAAATGGAGGCCAGATGG + Intronic
1007258558 6:40545714-40545736 AAGAGGAAAAGCAGGGGAAAAGG + Intronic
1007463181 6:42032811-42032833 TACAGGAAGATGAGGGCAGCTGG - Intronic
1007649231 6:43407613-43407635 TAGAGAAGGAGAAGGGCAGAAGG + Intergenic
1007786916 6:44285889-44285911 AGGAGGAAGAGGAGGGGAGAGGG + Intronic
1008497209 6:52145475-52145497 AGGAGGAAAGGGAGGGAAGAAGG + Intergenic
1008913322 6:56759861-56759883 TAGAGGACAAGAATGGCAGGTGG - Intronic
1009052179 6:58289578-58289600 TAGATGAAAAGGTGGGGAAATGG - Intergenic
1010259506 6:73798971-73798993 GAGAGGAGAAGGAGAGGAGAGGG - Intronic
1010489986 6:76464062-76464084 TATATGAAAAGGAAGGAAGATGG - Intergenic
1010560775 6:77347176-77347198 GGGAGGCAAAGGTGGGCAGATGG - Intergenic
1010862598 6:80931884-80931906 TCGAGGGAAAGGAGGGGAGGGGG - Intergenic
1010987802 6:82445731-82445753 AAAAGGAAAAAGAGGGGAGAAGG - Intergenic
1011270806 6:85578100-85578122 TAGGAGAAAAGGAGGCAAGAGGG + Intronic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1011695750 6:89911269-89911291 AAGAGGAAAAGAAGGGAGGAAGG - Intergenic
1012186136 6:96219373-96219395 AAGAAGAGAAGGAGGGGAGAGGG + Intergenic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1012671269 6:102050763-102050785 AAGGAGAAAAGGAGGGTAGAGGG + Intronic
1013031664 6:106339635-106339657 TGGAGGCAAAAGAGGGCATAAGG - Intergenic
1013064385 6:106669577-106669599 GAGAGGCCAAGGTGGGCAGATGG - Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014212342 6:118720191-118720213 AAGAAGAAAAGGAGGGAAAAAGG - Intergenic
1014430381 6:121363588-121363610 TTAAGTAAAAGGATGGCAGATGG + Intergenic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014826373 6:126052546-126052568 TATATAAAAAGGGGGGCAGAGGG - Intergenic
1015114092 6:129627641-129627663 TAGAGGGAAAGGAAGAAAGAAGG + Intronic
1015689502 6:135905897-135905919 TTGAGGAGAAGCAGGACAGAAGG + Intronic
1016153095 6:140768509-140768531 GAAAGGAAAAGGAAAGCAGAAGG + Intergenic
1016706649 6:147116607-147116629 TAGAGGCAAAGAAGGGAAGGAGG + Intergenic
1016767578 6:147812025-147812047 AAGAGGCAGAGGAGGGCAGGAGG + Intergenic
1016950257 6:149572903-149572925 GAGAGGCAGAGGAGGGTAGATGG - Intronic
1017052076 6:150402517-150402539 GAAAAGAAAAGGAGGGGAGAAGG + Exonic
1017067966 6:150547717-150547739 AAGAGGAAAGGGAGGGAGGAGGG + Intergenic
1017236441 6:152121536-152121558 TAAAGGAAAAGGATGGCAAGAGG - Intronic
1018291455 6:162296100-162296122 AAGAGAACAAGGAGGGGAGAGGG + Intronic
1018943477 6:168327748-168327770 TCAAAGAAAAGGAGGGGAGAAGG - Intergenic
1019162024 6:170075404-170075426 TGGAGAAAAAGAAGGGGAGAGGG + Intergenic
1019193188 6:170266122-170266144 AAGAGGAGAAGGAGGTCAGCTGG + Intergenic
1019420604 7:949017-949039 TTGGGGACAAGGAGGGCCGAGGG - Intronic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019504606 7:1384428-1384450 GAGAGGGAAAGGAGAGCACAAGG - Intergenic
1019555881 7:1631081-1631103 TAGATGAATAGGTGGGTAGATGG - Intergenic
1019660130 7:2219589-2219611 CAGAGGAATAAGGGGGCAGAGGG + Intronic
1020495437 7:8845859-8845881 TAGAAGAAAAGGAGAGCTGTAGG + Intergenic
1021122108 7:16807527-16807549 TAGAGGAAAAGAAGGGAGAAAGG - Intronic
1021345236 7:19519410-19519432 TGGAGGTAGATGAGGGCAGAAGG - Intergenic
1021360023 7:19701369-19701391 TACAGGGAACGGAGGGAAGAAGG + Intronic
1021437774 7:20640939-20640961 TATAGGAAAAGAAGAGAAGAGGG - Intronic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1022037161 7:26545387-26545409 TAGAGGGAAAAGTGGGCAGATGG + Intergenic
1022331672 7:29385206-29385228 TGGAGTAAAAGGAAGGCAGAAGG - Intronic
1023045727 7:36208608-36208630 TTGAGAAACAGGAAGGCAGATGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023379675 7:39594435-39594457 TAGAGGAAAAGAAAGGCATTGGG - Intronic
1023638282 7:42235648-42235670 GAGAGGAAAAGGGGAGCAGGAGG + Intronic
1024096453 7:45986602-45986624 AAGAGGAAATGGAGGCCCGAAGG + Intergenic
1024471370 7:49771041-49771063 AAGGGGAGAAGGAGGGCAAAGGG + Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1026305246 7:69134735-69134757 GAGAGGAAGAGGAGGAAAGAGGG - Intergenic
1026672841 7:72404654-72404676 GAGAGTAGAAAGAGGGCAGAGGG - Intronic
1026886297 7:73949379-73949401 TGGAGGAGAAGGAGAGGAGAAGG - Intergenic
1027386903 7:77667756-77667778 GAGAGGCAAAGAAGGCCAGATGG + Intergenic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029567716 7:101350020-101350042 TTGAGGCAGAGGTGGGCAGAGGG - Intergenic
1029693716 7:102199642-102199664 AAACGGAAAAGGAGGGCAGAGGG - Intronic
1030196520 7:106858677-106858699 TAAAAGAAAAGGAGGCAAGAGGG + Intergenic
1030406805 7:109125270-109125292 TAGGGGAGAAGGAGGGGAGGAGG + Intergenic
1030524679 7:110638840-110638862 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
1031089260 7:117333966-117333988 GAGCTTAAAAGGAGGGCAGAAGG + Intergenic
1031234916 7:119162763-119162785 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1031707795 7:125003952-125003974 TAGAGGAAAAGGGGAAGAGAAGG - Intergenic
1031739221 7:125407764-125407786 AAGTGGAAAAGGAAGGCAGAAGG + Intergenic
1032195564 7:129786392-129786414 TGGAGAAAAGGCAGGGCAGAGGG + Intergenic
1032469303 7:132166657-132166679 GAAAAGGAAAGGAGGGCAGAAGG + Intronic
1032495293 7:132356934-132356956 TAGAGGATGAGGAAGACAGAGGG + Intronic
1032508419 7:132453100-132453122 TGGAGGAAAAGGAGGAGAGAAGG + Intronic
1032527698 7:132592207-132592229 CAAAGGAAGATGAGGGCAGATGG - Intronic
1032536667 7:132670164-132670186 TAGAGGAAGCGGGGGTCAGAGGG - Intronic
1032757532 7:134905404-134905426 ATGAGGAAAATGAGGCCAGAGGG + Intronic
1032968314 7:137129325-137129347 GAGAGGAAAAGGACAGGAGAGGG - Intergenic
1033030350 7:137820340-137820362 AAGAGAAAATGGAGGGCAGTGGG - Intronic
1033085367 7:138336364-138336386 TGGAGGAAGAGGAGAGGAGAGGG - Intergenic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1033250176 7:139751962-139751984 AAGAAGAAAAGGAGGGAGGAAGG + Intronic
1033490049 7:141834564-141834586 AAGTGCAAAAGGAAGGCAGAAGG - Intergenic
1033573630 7:142658448-142658470 TGAGGAAAAAGGAGGGCAGAAGG - Intergenic
1034595384 7:152184994-152185016 GAGAGGCCAAGGTGGGCAGATGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035492708 7:159294235-159294257 TAGAGAAACTGGAGGGCAGGAGG - Intergenic
1035657363 8:1320119-1320141 GTGAGGAAGAGGAGGGCTGAAGG + Intergenic
1036190899 8:6669942-6669964 TAGAGGATCAGGAGGGCTAAAGG - Intergenic
1036198987 8:6750314-6750336 CAGAGGATAAGCAGGGCAGTGGG - Intronic
1036746714 8:11415081-11415103 TAGAGTAAAATGAGGTCATATGG - Intronic
1036756500 8:11474807-11474829 GAGAGGAAAAGGAGGGGGTAAGG + Intergenic
1036917648 8:12820220-12820242 AGGAGGAACAGGAGGGCAAAAGG + Intergenic
1037162801 8:15793348-15793370 CAGGGGAAAAGGAGTGGAGAAGG - Intergenic
1037400288 8:18489069-18489091 GAGAAGAAAAGGAGAGGAGAGGG + Intergenic
1037627949 8:20624644-20624666 AAGAGGAAGAGGAGGACAGGGGG - Intergenic
1037638309 8:20720217-20720239 TCTTGGAAAAGAAGGGCAGAGGG - Intergenic
1037742848 8:21621192-21621214 TAGAGGAAAAGGAGGGAGCTAGG + Intergenic
1037812234 8:22093954-22093976 GTGAGGCAAAGGTGGGCAGACGG - Intronic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1038340131 8:26679232-26679254 TAATGGAAAAGGAGGGCATTAGG - Intergenic
1038425581 8:27462019-27462041 TATAGGTAAAGGAGGCTAGAGGG + Intronic
1038483689 8:27918972-27918994 AAGAGGAGGAGGAGGGGAGAAGG + Intronic
1038893802 8:31757924-31757946 TAGAGGAGAAGGAGGAGTGAGGG - Intronic
1039094057 8:33864246-33864268 CAGGGGAAAAGGAGGTCAAATGG - Intergenic
1039548678 8:38428248-38428270 GGGAGGAAGAGGAGGGCACATGG - Intronic
1039684898 8:39790518-39790540 TACAGGAAAGTAAGGGCAGAGGG + Intronic
1040996679 8:53409296-53409318 TTGAGGAAAGGAAGGGAAGAAGG + Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041514861 8:58689464-58689486 GAGAGGAAAAGGAGGGGTGAGGG - Intergenic
1042052312 8:64724778-64724800 AAGAGAAACAGGAGGGCAGGAGG - Intronic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042166494 8:65950862-65950884 TAAAAAAACAGGAGGGCAGAAGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042878304 8:73460247-73460269 TAGAAGAAAATGGGGGCAGGAGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043731820 8:83693485-83693507 TTGAAGAAGAGGATGGCAGAGGG + Intergenic
1044199712 8:89419724-89419746 TAAAGGAAAGGAAGTGCAGATGG - Intergenic
1044465272 8:92495774-92495796 TATAGGAAAAGGAGATTAGATGG - Intergenic
1044474581 8:92611329-92611351 CAGAAGAAAAACAGGGCAGATGG + Intergenic
1044606312 8:94051098-94051120 TAGAGAATATGGAGGCCAGAAGG + Intergenic
1044629403 8:94263927-94263949 GAAAGGAAAAGGAGAGGAGATGG + Intergenic
1044686165 8:94827890-94827912 AGCAGGAATAGGAGGGCAGAAGG + Intronic
1044802340 8:95970426-95970448 TAGAAGCAGAGAAGGGCAGATGG + Intergenic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045481965 8:102600141-102600163 TAAAGGACAGGGAAGGCAGAGGG - Intergenic
1046795147 8:118363566-118363588 TTGAGGACCAGGAGAGCAGATGG - Intronic
1047060188 8:121216658-121216680 GAGAGAGAGAGGAGGGCAGAGGG + Intergenic
1047096980 8:121636402-121636424 GAGAGGAAGAGAAGGTCAGAAGG - Intronic
1047223779 8:122939848-122939870 TAGAGGAAAACGGGGTCTGATGG + Intronic
1047254762 8:123206948-123206970 AGGAGGAAAAGGAGGGGAGGGGG - Intronic
1047430911 8:124790845-124790867 AGGAGGAAAAGGTGAGCAGAGGG - Intergenic
1047933389 8:129751948-129751970 TTCAGGGAAAGAAGGGCAGAAGG - Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048359680 8:133687206-133687228 AGGAGGAGAAGGAGGGAAGATGG - Intergenic
1048399430 8:134050480-134050502 AAGAGGAAAAGAAGGGTAGATGG + Intergenic
1048431483 8:134375648-134375670 GAAAGGAAGAGGAGGTCAGAGGG - Intergenic
1048552831 8:135449456-135449478 TACAGGAAAGGGAGGGCAGGAGG - Intergenic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049393304 8:142382978-142383000 TGGGGGGAAAGGAGGGCAGGGGG + Intronic
1049465754 8:142750607-142750629 GAGAGGAAGAGGAGGGCACTGGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1051530324 9:18095002-18095024 TAGAGGGACAGGAAGGAAGAAGG - Intergenic
1052547438 9:29898139-29898161 AAGAGGAAACTCAGGGCAGAGGG + Intergenic
1052648303 9:31267677-31267699 AAGAGAGAAAGGAGGGAAGAAGG - Intergenic
1052886230 9:33650827-33650849 TGAGGAAAAAGGAGGGCAGAAGG - Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1055142437 9:72891122-72891144 TATAGAAAAAAGAGGGCAGGAGG + Intergenic
1055478688 9:76688662-76688684 AAGAGAAATGGGAGGGCAGATGG - Intronic
1056900718 9:90597004-90597026 TAGAGGAATGGGAAGGGAGAGGG - Intergenic
1057068388 9:92075414-92075436 TAGAGTAAAAGGAGGGGCGAGGG - Intronic
1057236726 9:93367012-93367034 GAGAGGACAAGGGGGGTAGAAGG - Intergenic
1057437891 9:95058912-95058934 GGAAGGAGAAGGAGGGCAGAGGG + Intronic
1057582601 9:96301125-96301147 TAGGGGAACACTAGGGCAGAAGG - Intronic
1057802130 9:98197067-98197089 AAGAAGAAAAGGGGGGAAGAGGG + Intergenic
1057838847 9:98468896-98468918 TAGAGGAGCAGCATGGCAGAGGG + Intronic
1057869557 9:98708115-98708137 CAGAGAAAAAGGAGTGGAGAAGG - Intronic
1058132013 9:101264277-101264299 TAAAGGAAATGTTGGGCAGAGGG - Intronic
1058605320 9:106715392-106715414 TAAAGGAAAAAGATGGGAGAGGG + Intergenic
1058626472 9:106938866-106938888 AACAGGAAAAAGAGGGGAGAAGG - Intronic
1058648168 9:107150026-107150048 GAGAGGAGAAGGAGGTCAGTCGG - Intergenic
1058939353 9:109798952-109798974 GAGGGGAAACGGAGGGCAGCAGG - Intronic
1059259184 9:112959497-112959519 TAGAGGCAAATGAGGGGACAGGG + Intergenic
1059323710 9:113488820-113488842 GAGAGGAAAAGGAGAGCGCAAGG - Intronic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059669312 9:116477977-116477999 GAGAAGAAACAGAGGGCAGAGGG + Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060171074 9:121461554-121461576 TAGAGGAAGAGAAGGGAAAAGGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060287084 9:122263422-122263444 TAGGGGGAAAGGAAAGCAGAGGG - Intronic
1060446138 9:123690027-123690049 GGGAAGAAAAGGAGGGAAGAAGG + Intronic
1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG + Intergenic
1061758831 9:132835615-132835637 CAGAGGAGAATGAGGCCAGAGGG - Intronic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1185535100 X:854870-854892 GAGAGGAAAATGAGGAAAGATGG - Intergenic
1185799533 X:2997144-2997166 TAGAAGAGAAGGAAGACAGATGG - Intergenic
1185842669 X:3407651-3407673 GGGAGGAAAAGGAGGGAAGCAGG - Intergenic
1185870888 X:3663963-3663985 AAGAGGAATGAGAGGGCAGAGGG + Intronic
1186649943 X:11548412-11548434 TAGAGGTAGAGAAGGTCAGAAGG - Intronic
1186697798 X:12055659-12055681 TAGAGGAAAATGAGGCCTAAGGG + Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187058131 X:15760247-15760269 TAGAGGAAAAGGAAGGGAGTAGG + Intronic
1187090547 X:16091616-16091638 TATAGCAAAAGGAGGGGTGAAGG - Intergenic
1187217852 X:17294549-17294571 TAAAAGGAAAGCAGGGCAGAAGG + Intergenic
1187323465 X:18263440-18263462 TAAAGGAAAATGAGACCAGATGG - Intronic
1187452858 X:19413853-19413875 AAGGGGAAAAGGAGAGAAGAAGG + Intronic
1187685459 X:21811553-21811575 AAGAGGAAAAGGGGAGTAGAGGG - Intergenic
1187765886 X:22641547-22641569 TACAGGAAAGGGATGGCAGCTGG - Intergenic
1187931080 X:24294154-24294176 TGGAGGTCAAGGCGGGCAGATGG - Intergenic
1188268212 X:28105032-28105054 GAGAGGAAAAACATGGCAGAAGG + Intergenic
1188680182 X:32994197-32994219 CAGAGGAAAATGGTGGCAGAAGG + Intronic
1190245435 X:48687654-48687676 TAGATGGAAAGGTGGGCACATGG + Intronic
1190344127 X:49322108-49322130 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190345222 X:49331653-49331675 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190346316 X:49341219-49341241 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190347567 X:49532248-49532270 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190348668 X:49541804-49541826 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190349769 X:49551360-49551382 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190350873 X:49560913-49560935 TAGAGGAAAAAGAGTCCGGACGG - Intronic
1190351974 X:49570471-49570493 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190353075 X:49580020-49580042 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190354176 X:49589567-49589589 TAGAGGAAAAAGAGTCCGGACGG - Exonic
1190355278 X:49599091-49599113 TAGAGGAAAAAGAGTCCGGACGG - Intronic
1190414073 X:50164007-50164029 TAGAGTAAAAAGAGGACAGGAGG + Intergenic
1190619440 X:52270445-52270467 GAGAGGAAAAAGAGGACAAAGGG + Intergenic
1190727220 X:53197501-53197523 TAGAGGAGAAGGAGGTAACAGGG - Intronic
1191184696 X:57596716-57596738 TGCAGGAAAGGGAGGGGAGAGGG - Exonic
1191832970 X:65434741-65434763 TAGAAGAAAAGAAGGGTAGTGGG + Intronic
1191869910 X:65737153-65737175 GAGCAGAAAAGGAGGGGAGAAGG - Intronic
1191943334 X:66503140-66503162 TAGAGTGAAAGAAGGGCAGGAGG - Intergenic
1192127849 X:68518614-68518636 TAGGGGACAGGGAGGGCAGGTGG + Intronic
1192235093 X:69290488-69290510 TAAATCAGAAGGAGGGCAGAGGG + Intergenic
1192508417 X:71705804-71705826 TAGAGAAAAAAGAGGAAAGAAGG + Intergenic
1192518279 X:71775749-71775771 TAGAGAAAAAAGAGGAAAGAAGG - Intergenic
1192805059 X:74501406-74501428 TAGGGTAGGAGGAGGGCAGAGGG + Intronic
1193039143 X:76986557-76986579 AAGAGGAAGAGGAGGGAAAATGG - Intergenic
1193312131 X:80022391-80022413 GAGAGGAAGAGGAGGAGAGAAGG + Exonic
1194728664 X:97428649-97428671 AAGAGAAGAAGGAGGGAAGAGGG - Intronic
1194832542 X:98641925-98641947 TAGAAAAAAAAGAGGGCAGTGGG + Intergenic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1196740103 X:119017212-119017234 GAGAGAAAGAGGAAGGCAGAGGG + Intronic
1196929146 X:120663617-120663639 TAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1197033886 X:121851962-121851984 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1197103374 X:122683938-122683960 AAGAAGAAAAGGGGGGGAGAAGG - Intergenic
1197187238 X:123601429-123601451 TAGGAGAAAAGGAAGGGAGAAGG + Intronic
1197214930 X:123859252-123859274 TAGAGGAAAAAGAAAGCAGATGG - Intergenic
1198637058 X:138711893-138711915 TTCGGGAAAAGGAGGGGAGAAGG - Intronic
1198671357 X:139084212-139084234 AAGAGGAGAAGGAGTGGAGAAGG + Intronic
1199529156 X:148827468-148827490 TCCAGGCAAAGGGGGGCAGAAGG - Intronic
1199599774 X:149535045-149535067 GAGAGGAGAAGGAGAGCAGGAGG - Intergenic
1199650865 X:149945202-149945224 GAGAGGAGAAGGAGAGCAGGAGG + Intergenic
1199711772 X:150474639-150474661 TAGAGCAAAAGGAGCCCACAAGG - Intronic
1199813690 X:151377219-151377241 TTGAGGAAATGAATGGCAGAGGG + Intergenic
1200307779 X:155045988-155046010 TAGAGGAAAAGGTGGGGGAAGGG - Intronic
1200752105 Y:6955812-6955834 TAGAGGAAAATAAAAGCAGAAGG - Intronic
1200793195 Y:7317548-7317570 AAGAGGAATGAGAGGGCAGAGGG - Intergenic
1200820488 Y:7577797-7577819 TAGAGGAAAGGAAGGAAAGAAGG + Intergenic
1201230831 Y:11862823-11862845 TAGAGGAAAGGAAGGAAAGAAGG + Intergenic
1202273896 Y:23096266-23096288 GAGAAGAGAAGGAGGGGAGAAGG + Intergenic
1202292130 Y:23324411-23324433 GAGAAGAGAAGGAGGGGAGAAGG - Intergenic
1202426892 Y:24730011-24730033 GAGAAGAGAAGGAGGGGAGAAGG + Intergenic
1202443899 Y:24940083-24940105 GAGAAGAGAAGGAGGGGAGAAGG - Intergenic