ID: 1104074241

View in Genome Browser
Species Human (GRCh38)
Location 12:125375625-125375647
Sequence GTGGCTGCCGGCTCTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104074236_1104074241 13 Left 1104074236 12:125375589-125375611 CCTGGATGGGCGAGCAAGTGGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1104074241 12:125375625-125375647 GTGGCTGCCGGCTCTCTTTGAGG 0: 1
1: 0
2: 3
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104074241 Original CRISPR GTGGCTGCCGGCTCTCTTTG AGG Intronic