ID: 1104074401

View in Genome Browser
Species Human (GRCh38)
Location 12:125376735-125376757
Sequence TATGAAGCCCACTGTCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104074388_1104074401 9 Left 1104074388 12:125376703-125376725 CCCCCTTCCCCTTAAAAGGGCTG 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074391_1104074401 6 Left 1104074391 12:125376706-125376728 CCTTCCCCTTAAAAGGGCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 136
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074395_1104074401 0 Left 1104074395 12:125376712-125376734 CCTTAAAAGGGCTGAGGCCGCCC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074394_1104074401 1 Left 1104074394 12:125376711-125376733 CCCTTAAAAGGGCTGAGGCCGCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074390_1104074401 7 Left 1104074390 12:125376705-125376727 CCCTTCCCCTTAAAAGGGCTGAG 0: 1
1: 0
2: 2
3: 11
4: 147
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074389_1104074401 8 Left 1104074389 12:125376704-125376726 CCCCTTCCCCTTAAAAGGGCTGA 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1104074393_1104074401 2 Left 1104074393 12:125376710-125376732 CCCCTTAAAAGGGCTGAGGCCGC 0: 1
1: 0
2: 0
3: 9
4: 58
Right 1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104074401 Original CRISPR TATGAAGCCCACTGTCTAAG GGG Intronic
900518284 1:3093606-3093628 TGTGAACCCCACAATCTAAGGGG - Intronic
900856497 1:5189524-5189546 TATGATGCTTACTGTCTAATTGG - Intergenic
901391237 1:8947640-8947662 CAGGAAGCCCACTGTCTCAGAGG - Intronic
907002523 1:50876005-50876027 GAAGCAGCTCACTGTCTAAGAGG + Intronic
907088205 1:51698567-51698589 TTTGGAGCCCACTGGCTTAGAGG + Intronic
908872219 1:68626428-68626450 TATGAAGCCCTCTCTCTAACTGG - Intergenic
908950042 1:69549432-69549454 TATGAATCCCACTATTTGAGTGG - Intergenic
910351831 1:86307406-86307428 TGTGCAGCCCACTGGCTATGAGG + Intergenic
913320668 1:117586321-117586343 AATGAAGCCCAAAGTCAAAGGGG - Intergenic
918181544 1:182089023-182089045 TATGGAGCCCACTGGCTCTGCGG - Intergenic
919187297 1:194168826-194168848 TAAGAAGATGACTGTCTAAGAGG + Intergenic
920827780 1:209437852-209437874 TATGAAGCCAGGTGTCCAAGGGG - Intergenic
921402336 1:214739122-214739144 TGTGAAGCCCAGTTTCTAACAGG + Intergenic
922987532 1:229877575-229877597 TTTGAAACCCACTTTCTATGTGG - Intergenic
1064675068 10:17752237-17752259 TATGCTGCCCACAGTCAAAGAGG + Exonic
1075170143 10:120105718-120105740 AATGGGGCCCACTGTCTCAGGGG - Intergenic
1077822089 11:5755607-5755629 TATGAACCCTATTGTCTATGGGG + Exonic
1086482535 11:87258369-87258391 TATGAATCCCTATGTATAAGAGG - Intronic
1093153546 12:15652894-15652916 TAGGAAGACAAATGTCTAAGTGG + Intronic
1098842940 12:75498779-75498801 TATGAGGAACAATGTCTAAGAGG + Exonic
1099200083 12:79666115-79666137 TAAGAAGCCAACTGTATTAGTGG + Intronic
1100660462 12:96692764-96692786 GAAGAAGCCCAGTGGCTAAGGGG + Intronic
1102398224 12:112605836-112605858 TATAAAACCCACTGGCTAAAGGG - Intronic
1103499134 12:121387202-121387224 AATGCAGCCCACTGTGTAACTGG - Intronic
1104074401 12:125376735-125376757 TATGAAGCCCACTGTCTAAGGGG + Intronic
1106741992 13:32654340-32654362 CATGAAGCCAACTGTATAAAAGG - Intronic
1108818060 13:54315258-54315280 TATGAATCCCAATATCGAAGAGG + Intergenic
1116729284 14:48602136-48602158 TATGGAGTCCACTATCTAATCGG - Intergenic
1117080584 14:52148086-52148108 TATGAAGCCCAATGTCCATTAGG - Intergenic
1120400362 14:84023130-84023152 TATGTAGCCCACAGTCTTAAAGG + Intergenic
1132971538 16:2691637-2691659 TAGGAAGCCCACTGTCCTGGAGG + Intronic
1134476433 16:14577967-14577989 CATAAAACCCACTTTCTAAGGGG + Intronic
1137665991 16:50249493-50249515 CATGAGGTCAACTGTCTAAGAGG - Intronic
1147546824 17:41408312-41408334 CAGGAAGCCCACACTCTAAGGGG - Intergenic
1150006329 17:61471146-61471168 TATGAAGCCCAGTGGCTAGAAGG - Intronic
1155838036 18:30612236-30612258 AATGAAGCCCACTGCGTATGGGG + Intergenic
1156122859 18:33865456-33865478 TATGGAGCCCACTGACACAGAGG + Intronic
1156267462 18:35501540-35501562 AATGAAGCCCATTGTCCACGAGG + Intergenic
1157096107 18:44686727-44686749 TATTATTCACACTGTCTAAGGGG - Intronic
1157474039 18:48009969-48009991 TATGCAGCCCACTTCCTAACAGG - Intergenic
1158866804 18:61645782-61645804 TTTGAGGAACACTGTCTAAGAGG - Intergenic
1161178313 19:2861906-2861928 TATGAGGCCCAGAGTCTAACTGG - Intergenic
1161433863 19:4250372-4250394 CATGGAGCCCACAGTCTAATGGG + Intronic
930374464 2:50547625-50547647 TATTAAGTCCACTGACTTAGGGG + Intronic
932008451 2:67951480-67951502 TCTGATGCCCACTGTCTCATCGG + Intergenic
932320592 2:70819598-70819620 GATAAAGGCCACTGTCCAAGGGG - Intronic
939469326 2:142599622-142599644 TATGAAGCCCTTTGTCTAGTGGG - Intergenic
940515690 2:154681526-154681548 TTGGAAGACCACTTTCTAAGAGG - Intergenic
941716798 2:168772591-168772613 TATTTAGCTCACTGGCTAAGAGG - Exonic
1171744192 20:28947866-28947888 TTTGAAGCCCATTGTGTAAAGGG + Intergenic
1172429860 20:34880679-34880701 TATTAAGCCCAATGTCTGGGTGG - Intronic
1174561727 20:51435386-51435408 CAGGCAGCCCACTGTCTAATGGG + Intronic
1176476347 21:7215427-7215449 TTTGAAGCCCATTGTGTAAAGGG - Intergenic
1178604923 21:34027810-34027832 TATGCAGCCCAGTTCCTAAGAGG - Intergenic
1180396020 22:12339937-12339959 TTTGAAGCCCATTGTGTAAAGGG - Intergenic
1180403729 22:12524827-12524849 TTTGAAGCCCATTGTATAAAGGG + Intergenic
1180738052 22:18033526-18033548 TAGGAAGCCCAGTCTCTAGGGGG - Intergenic
1181928136 22:26376862-26376884 TATGGAGCCCACAGTCTACTGGG + Intronic
949096664 3:94591-94613 TATAAAGCTCACTATCTAATAGG - Intergenic
949668544 3:6370342-6370364 TGTGAAGCCCAGTTTCTAACAGG - Intergenic
960323992 3:116272496-116272518 TATCATGCCCACTGGCTAATAGG + Intronic
964286019 3:155119304-155119326 TATGATGCCCACTGGCTACCTGG - Intronic
964926784 3:161968757-161968779 TATGTAATCCATTGTCTAAGAGG - Intergenic
967121138 3:186383856-186383878 CAGGAAGCCCACTGTCTCAGAGG + Intergenic
967138901 3:186536600-186536622 TATGGAGCTCACTGTCTATTGGG - Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
970270867 4:14345941-14345963 TATGAAGCCCACTCTCCAGTGGG - Intergenic
971726748 4:30324277-30324299 TCTGAAGCCCACTTGATAAGTGG + Intergenic
972568562 4:40290211-40290233 TATGAAGGCAGCTGTCTAGGAGG + Intergenic
975856918 4:78634328-78634350 TATGGAGCCCACTGCCCACGTGG + Intergenic
976726249 4:88218325-88218347 TATGAAGCTCACTTTCTAGACGG - Intronic
977258812 4:94772217-94772239 TATGAAGCCCACTGGCTGGCTGG - Intronic
977812046 4:101367535-101367557 TATCAAGCCAACTGACTTAGGGG + Intergenic
978471856 4:109076986-109077008 TGTGAGGCCCAGTTTCTAAGAGG + Intronic
979764949 4:124453381-124453403 TTTGAAGACCACTGTATTAGAGG - Intergenic
981369170 4:143938743-143938765 TGTGCAGCCCAGTTTCTAAGAGG + Intergenic
982375618 4:154687683-154687705 TATCCAGCCAACTATCTAAGGGG - Intronic
990964421 5:61429735-61429757 AATGAAGGCTACTGTCTAGGAGG + Intronic
991226159 5:64275605-64275627 TATTAAGCCCAGTTTCTATGAGG + Intronic
993787476 5:92161100-92161122 TCTGAAGCCCATTGATTAAGAGG + Intergenic
995748954 5:115433950-115433972 TAGGAAGCCCAATGTCTTTGGGG + Intergenic
1003725475 6:8757485-8757507 TGTGAAGCCAACTGTGTAACTGG - Intergenic
1005576730 6:27196691-27196713 TATGAAGACCTCTTTCTAGGTGG + Intergenic
1008090163 6:47285810-47285832 TATGAAGGCCTCTCTCCAAGGGG + Intronic
1008880421 6:56375634-56375656 TATGAAAACCACTGTGTAAAGGG - Intronic
1011399006 6:86939250-86939272 GATGAAGCCCACCTCCTAAGTGG + Intronic
1011495952 6:87936821-87936843 TATGAACCCCACTGATTAATAGG + Intergenic
1018560031 6:165092595-165092617 TATGCAGCCCACTGTCTAGGGGG + Intergenic
1018828788 6:167425988-167426010 TAGGAAGCCCTCTGTGTGAGTGG + Intergenic
1019494669 7:1332195-1332217 AATGAAGCCCACTGCTTCAGCGG - Intergenic
1020529637 7:9316551-9316573 TATGTAAACAACTGTCTAAGAGG - Intergenic
1028798892 7:94938098-94938120 TATGCAGCCCAGTATCTAACAGG - Intronic
1032300921 7:130686093-130686115 TATGAAGCCCACAGGTTTAGTGG + Intronic
1033931985 7:146534620-146534642 TATGAAGCCCCTTTTCTCAGTGG - Intronic
1034083475 7:148302139-148302161 TGTGAAGGCCACTTTCTTAGTGG + Intronic
1037459248 8:19092997-19093019 TAAGAAGACCACTGTCTAGGAGG - Intergenic
1041371665 8:57167260-57167282 TAAGAAGCTCACAGTCTAAATGG + Intergenic
1044278222 8:90326638-90326660 TGAGAAGACCACTGTCTATGAGG + Intergenic
1047417162 8:124674089-124674111 AATGAACCAGACTGTCTAAGGGG + Intronic
1050334252 9:4575447-4575469 GGTGGCGCCCACTGTCTAAGAGG - Intronic
1056632529 9:88305547-88305569 TCTGAACCCCACTGTTTAGGGGG + Intergenic
1058501219 9:105619279-105619301 TGAGAAGCTCACTGTCTAATTGG + Intronic
1059551514 9:115233876-115233898 AATGAAGCCCCCTTTCTGAGGGG - Intronic
1059939776 9:119347323-119347345 TATGGGGCCCACTGTCTATGCGG + Intronic
1203411777 Un_KI270579v1:18113-18135 TTTGAAGCCCATTGTGTAAAGGG - Intergenic
1185861622 X:3584712-3584734 TATGCAGCCCAGTTTCTAACAGG - Intergenic
1196008805 X:110864531-110864553 TTTGAAACCCACTGTCAAAGAGG + Intergenic
1198098152 X:133400485-133400507 TATGGAGCTCACAGTCTAAATGG - Intronic
1202047657 Y:20750654-20750676 TATGTAGCCCAGTTTCTAACAGG - Intergenic