ID: 1104074710

View in Genome Browser
Species Human (GRCh38)
Location 12:125378867-125378889
Sequence CTGAGCCTCATTTGCTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104074708_1104074710 27 Left 1104074708 12:125378817-125378839 CCAAAGAGCAGTGTGTGCTGCTG 0: 1
1: 0
2: 5
3: 32
4: 245
Right 1104074710 12:125378867-125378889 CTGAGCCTCATTTGCTCATATGG 0: 1
1: 0
2: 2
3: 30
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104074710 Original CRISPR CTGAGCCTCATTTGCTCATA TGG Intronic
903380310 1:22892137-22892159 CTGAGCATCATTTTCCCATCTGG + Intronic
903605971 1:24575454-24575476 AGGAGCCTCATTTCCTCATCTGG - Intronic
904773093 1:32891950-32891972 CTGAGCCTCAGTTTCTTATCTGG + Intronic
905009886 1:34740104-34740126 CTGAGCCTCATTTGTTCCATTGG - Intronic
905297518 1:36963550-36963572 CTGAGCCTCAGATGTTCAAAGGG - Intronic
905733888 1:40313483-40313505 CTGAGCCTTAGTTTCTCATCTGG + Intronic
906196919 1:43935371-43935393 CTGAGCCTTGTTTGCTCATCTGG + Intronic
907386059 1:54125934-54125956 CTGAGCCTCAGTTCCTCCCAGGG - Intergenic
907853691 1:58280901-58280923 CTTAGCCTCTTTTGCTCTTACGG - Intronic
909628152 1:77742532-77742554 ATTAGCTTCATTTGCACATAAGG + Intronic
912709911 1:111942811-111942833 CAGAGCCTCATTTCCTCCTCTGG - Intronic
913220132 1:116653450-116653472 CTGGGCCTCATTTGAAGATAAGG - Intronic
913390893 1:118311194-118311216 GTGAGCTTCATGTACTCATATGG - Intergenic
915606743 1:156956833-156956855 CTGACCATCATCTGCTCATGGGG - Intronic
918315352 1:183318338-183318360 CAGAGCCCCATTTCCTCATCTGG - Intronic
919836933 1:201581354-201581376 CTGATGCTCATTTTCTCAGATGG - Intergenic
920227989 1:204451639-204451661 CTGTGCCTCAGTTTCTCATCAGG + Intronic
921424184 1:214983608-214983630 CTGAGCCTCAGTTTCCCATCTGG - Intergenic
923671183 1:236042612-236042634 ATGAGCCACCTTAGCTCATAAGG - Intronic
924474390 1:244370413-244370435 CTGAGCCTCAGTTTCTTATCAGG + Intronic
924708723 1:246517919-246517941 CTGGCGCTCATTTGCTCAGAGGG - Intergenic
1062992064 10:1829067-1829089 CTAACCTTCATTTGCTCAAAAGG - Intergenic
1063384938 10:5610333-5610355 CTGAGCCTCATTTTTTCTTCTGG + Intergenic
1065816039 10:29483352-29483374 TTCAGCCTCATTTGCTAAGAAGG + Intronic
1065956856 10:30701548-30701570 TTCAGCCTCATTTGCTAAGAAGG - Intergenic
1067303998 10:45041966-45041988 ATATGCCTGATTTGCTCATAAGG - Intergenic
1068468233 10:57424347-57424369 CAGAGGCTCATTTTTTCATATGG - Intergenic
1068587072 10:58811784-58811806 TTGAATGTCATTTGCTCATAAGG - Intronic
1070325410 10:75385481-75385503 CTGAACCTCATTCACTCATGTGG + Intergenic
1074194938 10:111175438-111175460 ATGAGCATAATTTGCTCACAGGG + Intergenic
1074912563 10:117924757-117924779 CTGAGCCCCAGTTGCTCATGTGG + Intergenic
1076206559 10:128609029-128609051 CTGAGCCTTATTTGCTCCACAGG - Intergenic
1079137426 11:17783780-17783802 CTGGGCCTCATTTCCTCATCTGG - Intergenic
1080087612 11:28303965-28303987 CTGACCCTCATTTCCTCATCTGG + Intronic
1080711770 11:34755223-34755245 CTGAGCCTCATTTTCTCACTTGG - Intergenic
1081101665 11:39009396-39009418 TTGAGAATCATTTGCACATAAGG - Intergenic
1081584161 11:44372698-44372720 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1081976697 11:47239968-47239990 CTGAGCCCCACTCGCTCATCTGG + Exonic
1083069904 11:59967344-59967366 CTGAGCCTCATCTACTCATGCGG - Intergenic
1083711081 11:64548791-64548813 CTGAGCTTCATTTCCTCAGATGG - Intergenic
1083855989 11:65393384-65393406 CTGAGGCTCATTTGCTCTATGGG + Intronic
1085219888 11:74864964-74864986 CCCAGCCTCATTGGCTCAGAGGG - Intronic
1086993772 11:93333577-93333599 CTAAGCTTCATCTGGTCATATGG - Intronic
1087212559 11:95458621-95458643 CTGAGCCTCCTGTCCTCATAAGG - Intergenic
1088696348 11:112369508-112369530 CTAAGCCTCAGTTCCTCATCTGG - Intergenic
1089180858 11:116581927-116581949 CTGAGCCTCAGTTGCTCATTAGG - Intergenic
1089190847 11:116652108-116652130 CTGAGCCTCAGTTTCTCCTCTGG + Intergenic
1090413869 11:126527549-126527571 CTGTGCCTCATTTTCCCATCTGG - Intronic
1091189618 11:133680151-133680173 CTGAGCCTCCTTTGGTCTCATGG - Intergenic
1091435455 12:469301-469323 CTAAACCTCATTTAGTCATAAGG - Intronic
1092881905 12:12893174-12893196 CTGGGCCTGAGTTCCTCATAGGG + Intronic
1093888396 12:24489779-24489801 CAGAGCCTTGTTTGCTGATAAGG - Intergenic
1095563376 12:43591722-43591744 CTGAGCCTCATTTTATGAAATGG + Intergenic
1096053576 12:48632140-48632162 CTCTGCCTCATTTTCTCATCAGG - Intergenic
1099366981 12:81778578-81778600 CTTAGCCAGATTTGCTCATGGGG - Intergenic
1101740006 12:107493351-107493373 CTGGGCCTGATTTGCACAGAAGG - Intronic
1102770122 12:115468656-115468678 CTGAGCCTCATTTTCCTATTTGG + Intergenic
1104074710 12:125378867-125378889 CTGAGCCTCATTTGCTCATATGG + Intronic
1108518022 13:51221297-51221319 CTGTGCCTCATTTGATCCTCAGG - Intergenic
1112696119 13:101950078-101950100 CTGAGCATCTCTTGCTTATAAGG - Intronic
1116806034 14:49494732-49494754 CTGAGGCTCATTTGGTCCTGGGG - Intergenic
1118617793 14:67586829-67586851 CTGGGCCTCCTTTTCTCAGAAGG + Intronic
1121101231 14:91251846-91251868 CTGAGTCTCACTATCTCATAGGG - Exonic
1121310234 14:92931829-92931851 CTGAGCCTCATTTGTCCACCTGG - Intronic
1122801150 14:104230221-104230243 CTGAGCCTCAGTTTCCCATCAGG - Intergenic
1122801624 14:104233240-104233262 CTGACCCTGACTTGCTGATATGG + Intergenic
1128817949 15:70628197-70628219 CTGGGCCTCATTTGCTCCTTTGG + Intergenic
1129520375 15:76182232-76182254 CTGAGCCTCAGCTTCTCATTGGG + Intronic
1129882070 15:79013639-79013661 CTGAGCCTGCCTTGCTCATCTGG - Intronic
1131219073 15:90566061-90566083 AACAGCCTTATTTGCTCATAAGG + Intronic
1135569081 16:23534629-23534651 CTGAGCCTCAGTTGCATATCTGG - Intronic
1137610049 16:49811911-49811933 CTGAGAGCCATTTGCTCATCTGG + Intronic
1138078925 16:54070217-54070239 CTGAGTCTCATTTGTGCTTAAGG - Intronic
1138097051 16:54220010-54220032 CTGACCCTCAGTTTCTCATCTGG + Intergenic
1138434357 16:56988984-56989006 CTGAGCCTCAGTGGCTCACCTGG + Intergenic
1139564101 16:67762538-67762560 CTGACTCACATTTGGTCATATGG - Intronic
1140965217 16:79959364-79959386 CTGAGGCTCATTTGCAAATGAGG + Intergenic
1141021761 16:80503298-80503320 ATGATGCTCATTTCCTCATATGG - Intergenic
1143256342 17:5560709-5560731 TGGAGCCTCAGTTGCTCACAAGG + Intronic
1144191436 17:12850408-12850430 CTCAGTTTCATTGGCTCATAAGG + Intronic
1144890255 17:18490294-18490316 CTGAGCCTCATTGCCTCACCAGG + Intronic
1145141961 17:20454024-20454046 CTGAGCCTCATTGCCTCACCAGG - Intronic
1145252316 17:21303308-21303330 CGGAGCCACAGTTGCTCATAGGG - Intronic
1145258560 17:21341364-21341386 CTGAGCCTCATTGGCTCACTTGG - Intergenic
1145318065 17:21746641-21746663 CTGAGCCTCATTGGCTCACCTGG + Intergenic
1145388163 17:22433786-22433808 CTGAGCCTCAGTTTTTCATAGGG + Intergenic
1147568424 17:41552030-41552052 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1149106644 17:52975372-52975394 CTGAGCCACATTCACTCCTAGGG + Intergenic
1153908127 18:9682012-9682034 CTGGCCCTCATTTGCTCACAGGG - Intergenic
1155310049 18:24514646-24514668 TTGAGCCTCATTGGCTGAGACGG - Intergenic
1162004883 19:7771384-7771406 CTGAGCCCCAGTTGCCCACATGG + Intergenic
1163326201 19:16604894-16604916 GTGAGCCTCATCTGTTCATATGG + Intronic
1164253878 19:23510244-23510266 CTGGGGCTTATTTGCTCATAGGG - Intergenic
1164423527 19:28119155-28119177 ATGAGCCTTATTGGCTTATATGG - Intergenic
1164954221 19:32367701-32367723 CTGAGCCTCATTTACTAATATGG + Intronic
1166342604 19:42147927-42147949 CTGAGCCTTATTTCCTCCTCTGG - Intronic
1166745049 19:45137768-45137790 CTGAGCTTGGTTTCCTCATAGGG + Intronic
1167763084 19:51461699-51461721 CTGACCCTCATTTCCCCACAGGG - Intergenic
1168280690 19:55303943-55303965 CTGGGCCTCATTTCCTCACCTGG + Intronic
925766570 2:7242148-7242170 CTGAACACCATTTGCTCAGAAGG + Intergenic
928661298 2:33504865-33504887 CTCAGCCTCATGTGCTCACTAGG - Intronic
928774247 2:34739380-34739402 CTGAGTCTCATTCTCTCATAAGG + Intergenic
929231537 2:39565391-39565413 CTGGGACTCATTTGCTGACAAGG - Intergenic
932115300 2:69041459-69041481 CTGTGTCTCATTTGCTCTTCTGG + Intronic
932629365 2:73325162-73325184 CAGAGCCCCATTTGGTCCTAGGG - Intergenic
938558188 2:132445752-132445774 CAGATCATCATTTCCTCATAGGG - Intronic
942095592 2:172534310-172534332 CTGTGCCTGACTTGCACATATGG - Intergenic
942788190 2:179726455-179726477 CTGGGCCTCTGTTGCTCATTAGG + Intronic
946669679 2:222089425-222089447 TTGAGCCTCAGCTGCTCACAGGG + Intergenic
948348594 2:237320000-237320022 CTGAGCCCCAGTTGCTCTCAAGG + Intergenic
948642842 2:239386270-239386292 CTGAGACTCAAATGCTCAAACGG + Intronic
1169550302 20:6695431-6695453 TTAAGCCTCAGTTGCTCATAAGG - Intergenic
1169818365 20:9682456-9682478 CTGAGCTTCATTTCCTCTCAAGG + Intronic
1170361630 20:15552826-15552848 CTGAGCCTCAGTTGCCTACATGG + Intronic
1173580079 20:44140896-44140918 CTGAGCCTCAGTTTCTCCAACGG - Intronic
1173899449 20:46576450-46576472 CTGAGCCCCATTTCCTCAGCCGG + Intronic
1174200820 20:48805300-48805322 CTGAGCCTCAGTTTCTTATCTGG - Intronic
1175670803 20:60901214-60901236 CTGAGCCCCAGTTGTTCACAAGG + Intergenic
1180821426 22:18831470-18831492 CTGGGCCTCATTTGAAGATAAGG - Intergenic
1181191552 22:21144575-21144597 CTGGGCCTCATTTGAAGATAAGG + Intergenic
1181207646 22:21265935-21265957 CTGGGCCTCATTTGAAGATAAGG - Intergenic
1182765316 22:32753921-32753943 CAGAGCCTCAATTTCTCATATGG - Intronic
1182860887 22:33558301-33558323 CTGAGCTTCATTTGGAGATAAGG + Intronic
1183026965 22:35072428-35072450 TTGAGCTTCAGTTACTCATAGGG - Intronic
1183950455 22:41349651-41349673 CTGAGCCTCCAGTGCTCATCTGG + Intronic
1185249875 22:49795584-49795606 CGGAGCCTCCTTTGCCCCTAGGG - Intronic
1203219274 22_KI270731v1_random:29481-29503 CTGGGCCTCATTTGAAGATAAGG + Intergenic
1203271551 22_KI270734v1_random:57346-57368 CTGGGCCTCATTTGAAGATAAGG - Intergenic
950679956 3:14578318-14578340 CTGAGCCTCAGTTCTTCATCTGG + Intergenic
950832078 3:15885003-15885025 CGCAGCCACATTTGCCCATAAGG - Intergenic
953863604 3:46565291-46565313 CTGAGCCTGATGTTCTCATGTGG + Intronic
954039396 3:47873023-47873045 CTGAGCTTTATTTCCTCATCGGG + Intronic
954039502 3:47874145-47874167 CTGAGCTTTATTTCCTCATCTGG + Intronic
955565497 3:60239944-60239966 CTAAGCCTCAGTTTCTCACAGGG + Intronic
957690973 3:83567663-83567685 CTGAGCTACATTAGCTTATATGG + Intergenic
961057840 3:123804110-123804132 GGGAGTATCATTTGCTCATAAGG + Intronic
961931271 3:130535931-130535953 CTGAGCCTCAACTCCTCATCTGG + Intergenic
963993400 3:151679431-151679453 CTGAGCCTCCTTTACTTATAAGG + Intergenic
966934144 3:184694808-184694830 CTGAGCCTCAGTTGCTGAGTTGG - Intergenic
967241430 3:187443496-187443518 CTTAGCCTGATTTACTCAGATGG - Intergenic
967674165 3:192276497-192276519 ATGAGAATCATTTTCTCATAAGG - Intronic
975179366 4:71326407-71326429 CTGAGCCTCATTCCTTCATGTGG + Intronic
975318475 4:72982178-72982200 CTGGGCTTCATCTGCTCATGAGG + Intergenic
975527270 4:75364284-75364306 CTGAGCCTCATTCCTTCATCTGG + Intergenic
976246080 4:83007466-83007488 CTGAGCTTCATTTACTTATAGGG + Intronic
978544026 4:109851262-109851284 CTCAACCTCATTTTCCCATATGG - Intronic
982290454 4:153776468-153776490 CTGGGCCCCATTTGTTCTTACGG - Intergenic
984707257 4:182856519-182856541 CTGAGCCTCCTCTGCTCGAAAGG + Intergenic
984957238 4:185057662-185057684 TTGATCCTCATTTACACATATGG + Intergenic
985221024 4:187705577-187705599 CTGAGCCTCATTCTCTCTTGAGG - Intergenic
986192588 5:5510874-5510896 CTGAGCCTCCATTGCACACACGG + Intergenic
987037682 5:14034711-14034733 CTAAGCCTTAGTTGCTGATATGG - Intergenic
993682219 5:90893736-90893758 CTGAATCTTATTTACTCATAAGG + Intronic
993880028 5:93350981-93351003 CTGAGCCTTAATAGCTCTTATGG - Intergenic
995360208 5:111288659-111288681 CTTAGCCTCCTTTCCTCTTATGG + Intronic
995833450 5:116377974-116377996 CAGAGCCTCAGTTGTTCAGAGGG - Intronic
995887365 5:116911027-116911049 CTGAGCCTCAATTTCCCTTATGG - Intergenic
996969248 5:129343794-129343816 CTGAGCCCCAGTTGCCCAAATGG - Intergenic
999197417 5:149791977-149791999 CTCAGCATCATTTCCCCATAGGG - Intronic
999959305 5:156736684-156736706 CTGAGCCTCATCTGTTCAATAGG + Intronic
1000547030 5:162616160-162616182 CTGTCCCTCATTTGTTAATATGG + Intergenic
1001150275 5:169221273-169221295 CTGAGCCATATTTGCTCTAATGG - Intronic
1001796580 5:174507156-174507178 TTATGCCTCATTTGCTAATAAGG + Intergenic
1002411931 5:179087007-179087029 GTGAACTTCATTTGCTCTTATGG - Intergenic
1003169331 6:3708747-3708769 CTGAGCCTTAATTATTCATATGG - Intergenic
1004390627 6:15206699-15206721 CTGACTTTCATTTGCTCAGAGGG - Intergenic
1004882921 6:20026473-20026495 CTGAGCCTCAGTTTCCCATCTGG + Intergenic
1005077032 6:21918673-21918695 CTGAGCCTCAGTTTCTCTGATGG + Intergenic
1008152857 6:47976258-47976280 CTCAGCATCCTTTTCTCATAGGG + Intronic
1010378214 6:75199271-75199293 CTGGGCCTCATTTTCTCATTTGG + Intronic
1012510423 6:99994748-99994770 CTCATCCTCAGTTGCTCATTTGG + Intergenic
1012651877 6:101764175-101764197 CTGAGTGTCATTTGCTCTTGTGG + Intronic
1012799727 6:103809805-103809827 CTCAGTCTCAATTGCCCATAAGG - Intergenic
1016331715 6:142959610-142959632 TTGAGCCTCATTTACGCATGAGG + Intergenic
1016468179 6:144347440-144347462 CTGAGCCTCTTCTGCACATCAGG - Intronic
1019158829 6:170056326-170056348 CTGAGCCTCACTTGCCCTTCTGG - Intergenic
1019703879 7:2488260-2488282 CTGAGCCTCAGTTTCTCCTCTGG - Intergenic
1030870312 7:114747557-114747579 CTGAGCCACATGTGGTCATCCGG + Intergenic
1031723590 7:125208207-125208229 CTCAGCATCATTTGTTGATAAGG + Intergenic
1032025807 7:128441389-128441411 CTCAGCCTCATTTACACACATGG - Intergenic
1034838772 7:154376101-154376123 GAGAGGCTTATTTGCTCATATGG + Intronic
1037026398 8:14043629-14043651 CTGAGCCTCAGATGTTCATAGGG - Intergenic
1037361308 8:18077184-18077206 ATGAGCTTCATTTGCTCTTGTGG - Intronic
1037504011 8:19512639-19512661 CTGAGCCTTATTTTCTCAAACGG - Intronic
1039977117 8:42376572-42376594 CTGAGTCTTATTTCCTCATCTGG + Intronic
1041560033 8:59206927-59206949 CTGATGCTCATTTGTTCAAAAGG + Intergenic
1041656817 8:60360765-60360787 CTGAGGCTCATTTACACATCTGG + Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1043697685 8:83241438-83241460 CTTAACCACATTTGCTGATAAGG + Intergenic
1046211008 8:111076130-111076152 ATGAGCCTCATTTTCTAATGGGG + Intergenic
1046723940 8:117654407-117654429 CTGAGCCTACTTTCCTCACAGGG + Intergenic
1046776574 8:118170164-118170186 CTAAGCCTCAGTTTCTCATTTGG + Intergenic
1046850178 8:118963253-118963275 CTGAGTCTCATTTCCTAATTTGG - Intergenic
1048162179 8:132031691-132031713 CTGAGCCTCAGCTGCTCACCAGG + Intronic
1048371130 8:133777123-133777145 CTGAGCCCCATTTCCTCATCTGG - Intergenic
1050787333 9:9421846-9421868 CTGAGCATCATTTCATCATCAGG - Intronic
1051631646 9:19146267-19146289 ATGAGCCTCATATGCTCACCTGG - Intronic
1056182198 9:84095892-84095914 CTGAGCCTCATCTGTAAATAGGG - Intergenic
1058110573 9:101028069-101028091 CTAAGCCTCCTTTGATGATAGGG - Intergenic
1058447846 9:105069532-105069554 CTGATCCTCCCTTTCTCATACGG + Intergenic
1060408512 9:123384486-123384508 CTGAGCCTCAGGTGCTCAGGTGG + Intronic
1188295956 X:28448618-28448640 CTGAGCCTCAATTTCTCATCCGG - Intergenic
1188518846 X:31015476-31015498 CTGTGCCTCATCAGCTCATCTGG - Intergenic
1189207286 X:39252812-39252834 TTGAGCCCCAGTTGCTCAAAGGG - Intergenic
1189234935 X:39479483-39479505 TTGAGCCTCAGTTGCCCAAAGGG + Intergenic
1192392680 X:70746963-70746985 TTGAGCCTCATTGGCTCAAGGGG + Intronic
1196111698 X:111953533-111953555 CTGAGCCTCATTTTCTCCCTTGG - Intronic
1198422894 X:136485586-136485608 ATGAGCCATATTTGCTCATTTGG - Intergenic
1198564627 X:137891552-137891574 CTGAGCCTCAGCTTCTGATATGG - Intergenic
1202244804 Y:22809242-22809264 CTGAGGCCCACATGCTCATATGG - Intergenic
1202255720 Y:22918151-22918173 CTGAGGCCTATTTGCTCATATGG - Intergenic
1202267736 Y:23038536-23038558 CTGAGGCCCATAGGCTCATATGG - Intergenic
1202397793 Y:24442988-24443010 CTGAGGCCCACATGCTCATATGG - Intergenic
1202408711 Y:24551900-24551922 CTGAGGCCTATTTGCTCATATGG - Intergenic
1202420728 Y:24672280-24672302 CTGAGGCCCATAGGCTCATATGG - Intergenic
1202450058 Y:24997802-24997824 CTGAGGCCCATAGGCTCATATGG + Intergenic
1202462072 Y:25118180-25118202 CTGAGGCCTATTTGCTCATATGG + Intergenic
1202472988 Y:25227099-25227121 CTGAGGCCCACATGCTCATATGG + Intergenic