ID: 1104076829

View in Genome Browser
Species Human (GRCh38)
Location 12:125397258-125397280
Sequence CATAGAACAGTGAAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104076829_1104076833 16 Left 1104076829 12:125397258-125397280 CCAGCCAACTTCACTGTTCTATG 0: 1
1: 0
2: 2
3: 17
4: 238
Right 1104076833 12:125397297-125397319 CTGTTTCTTTTGCACACAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104076829 Original CRISPR CATAGAACAGTGAAGTTGGC TGG (reversed) Intronic
901464103 1:9409814-9409836 CACAGAACAGTGGAGGTGTCAGG - Intergenic
901707600 1:11087343-11087365 CCTAGACCAGTCAAGTTGGGAGG - Intronic
902162599 1:14543403-14543425 CTGTGAACTGTGAAGTTGGCTGG + Intergenic
905523018 1:38614645-38614667 AAGTGAACAGTGAAATTGGCAGG - Intergenic
907881159 1:58550351-58550373 GAAAGAACAGTGCAGTGGGCTGG - Intergenic
908300470 1:62757126-62757148 TATAGAACACTGAGGTTGCCAGG - Intergenic
909196433 1:72631762-72631784 CTTAGAATATTGAAGTTGCCTGG + Intergenic
910527813 1:88201251-88201273 CATAGAAAACTGAAGTAGGGAGG + Intergenic
911129714 1:94375955-94375977 TATAGAACACTGAGGTTGCCGGG + Intergenic
911751470 1:101501732-101501754 TATAGAACACTGAGGTTGCCAGG - Intergenic
913533274 1:119748159-119748181 TTTAGAACAGGGAAGTGGGCTGG + Exonic
913981341 1:143520030-143520052 CAGAGGACAGTGAAGTGGCCAGG + Intergenic
914872318 1:151485283-151485305 CATAAAACAGAAAATTTGGCTGG - Intergenic
916083731 1:161253277-161253299 TATAGAACACTGAGGTTGCCAGG - Intergenic
916503545 1:165407555-165407577 GATAGAGCAGAGAAGATGGCTGG - Intronic
916608736 1:166368845-166368867 AATGGAACAGTGAAATTGGATGG + Intergenic
918390954 1:184061188-184061210 AATAGAGTAGTAAAGTTGGCAGG - Intronic
918967346 1:191368940-191368962 CAAAGAACAAGGAAGTTAGCAGG - Intergenic
919206336 1:194424858-194424880 TATAGAACACTGAGGTTGCCAGG - Intergenic
919460222 1:197868269-197868291 CATTTAAAAGTGGAGTTGGCAGG + Intergenic
920578352 1:207080025-207080047 CATATAAAAGTGAGGGTGGCGGG + Intronic
921865965 1:220088195-220088217 CATAGAAAAGAAAATTTGGCAGG + Intronic
921926497 1:220714135-220714157 CATAGAAAAATAAAGTTGGTTGG - Intergenic
923431674 1:233928076-233928098 CCAAGAACAGGGAAGTTGGAAGG - Intronic
924260693 1:242227658-242227680 TAAAGAACAGTGAAGAGGGCTGG - Intronic
1063152137 10:3346568-3346590 CATAGCACAGTGGAGTTAGCTGG + Intergenic
1063321646 10:5057375-5057397 TATAGAACACTGAAGTTGCCAGG + Intronic
1063347219 10:5323333-5323355 CAGAGAACTCTGAAGTTGGAAGG + Intergenic
1063414864 10:5865034-5865056 CATAGAACACAGAGGTTGCCAGG - Intronic
1068404890 10:56575359-56575381 TATAGAACACTGAGGTTGCCAGG + Intergenic
1069612532 10:69784269-69784291 TAAAGAACAGAGAAGTTGGGTGG + Intergenic
1069750331 10:70741248-70741270 CATACACCAGTGAAGGTGGAGGG + Intronic
1069912516 10:71768042-71768064 CATAGAAGCGTGAGGGTGGCTGG - Intronic
1070676710 10:78416899-78416921 CAGAGAACAGTGGAGATGGAGGG - Intergenic
1070796200 10:79218139-79218161 CATAGAGGAGTGGGGTTGGCTGG + Intronic
1072192196 10:93085188-93085210 CATAAATGAATGAAGTTGGCTGG - Intergenic
1072453659 10:95558862-95558884 CTAAGAACAGTGGAGTTGTCAGG + Intronic
1074238812 10:111615077-111615099 CAAGGAACAATAAAGTTGGCTGG + Intergenic
1074936713 10:118189128-118189150 CACAGAACATTGAATTTGGAAGG - Intergenic
1075743521 10:124710488-124710510 CATTCCCCAGTGAAGTTGGCCGG - Intronic
1077342394 11:2031929-2031951 CCTAGAACAGTGGGGTGGGCCGG - Intergenic
1078951225 11:16136730-16136752 CATATAAAAGTTATGTTGGCTGG - Intronic
1079762412 11:24345787-24345809 CATAGATTTATGAAGTTGGCTGG - Intergenic
1081899439 11:46615507-46615529 CATAGAAAAGTTATGTAGGCTGG - Intronic
1083800517 11:65043982-65044004 CTTACAACACTGAAGTGGGCAGG - Intronic
1085574732 11:77591967-77591989 TATAGAAGAGTGAAGGGGGCCGG + Intronic
1086008923 11:82074638-82074660 CAAAGAACAGCTAAGTTGTCTGG + Intergenic
1086317460 11:85609348-85609370 TATAGAACACTGAGGTTGCCTGG - Intronic
1086443203 11:86848730-86848752 TATAGAACAACGAGGTTGGCAGG - Intronic
1086630413 11:89011467-89011489 TATATTACAGAGAAGTTGGCAGG + Intronic
1087075064 11:94121035-94121057 TATAGAACACTGAGGTTGCCAGG - Intergenic
1087458930 11:98422146-98422168 TATAGAACACTGATGTTGCCAGG + Intergenic
1088392753 11:109333677-109333699 CAGAGAACAGTGGAGTAGACAGG + Intergenic
1088492610 11:110402236-110402258 TATAGAACACTGAAGTTGCCAGG - Intergenic
1089032714 11:115349780-115349802 CCTAGAACAGTGAAATAGGGAGG - Intronic
1090867186 11:130711433-130711455 CAGGGAAGAGTGAGGTTGGCTGG + Intronic
1090920326 11:131201090-131201112 CTTAGAACCCTGAAATTGGCAGG - Intergenic
1091095484 11:132817623-132817645 AATAGAATAATGAACTTGGCAGG + Intronic
1202825380 11_KI270721v1_random:87118-87140 CCTAGAACAGTGGGGTGGGCCGG - Intergenic
1092472375 12:8791122-8791144 TATAGAACACTGAGGTTGCCAGG - Intergenic
1093806017 12:23434285-23434307 CATAGAAAAGGGTAGGTGGCAGG - Intergenic
1093855743 12:24099957-24099979 CATAGAATAGTAGAGTTGGAAGG - Intergenic
1094113612 12:26886292-26886314 CACAGAGCAGTGATGTTGGCAGG + Intergenic
1098377257 12:69830127-69830149 CATAGAACATTGAAACTGTCTGG + Intronic
1098510902 12:71312988-71313010 CATAGGACTGTGAAGTTTTCTGG + Intronic
1099814338 12:87625657-87625679 CCTAGACCAGTGGAGTTGGAAGG + Intergenic
1100595360 12:96067019-96067041 TGTAGAGAAGTGAAGTTGGCAGG - Intergenic
1103799773 12:123530461-123530483 TAAAAAACAGTGAAGTTGGCTGG - Intronic
1104076829 12:125397258-125397280 CATAGAACAGTGAAGTTGGCTGG - Intronic
1106162768 13:27215569-27215591 TATAGAACACTGAGGTTGCCAGG - Intergenic
1106878841 13:34106805-34106827 CATTGAGGGGTGAAGTTGGCGGG - Intergenic
1107796788 13:44061250-44061272 CAAAGAACAAAGAAGTGGGCAGG + Intergenic
1108514174 13:51182285-51182307 CATAGGAAAGTGCAGCTGGCTGG - Intergenic
1108848672 13:54703094-54703116 TATAGAACACTGAGGTTGCCAGG - Intergenic
1109500677 13:63233595-63233617 CATAGAGAGGTGAAGCTGGCTGG + Intergenic
1110546622 13:76763205-76763227 CATAGAACTGTAAAGCTGGAAGG - Intergenic
1111367773 13:87272080-87272102 TACAAAACACTGAAGTTGGCTGG - Intergenic
1111372596 13:87336342-87336364 TATAGAACACTGAGGTTGCCAGG - Intergenic
1111718078 13:91906038-91906060 CTCAGAACAGGGACGTTGGCAGG - Intronic
1111774001 13:92636056-92636078 CATAGAACAGTGAAGCCTTCTGG - Intronic
1112808177 13:103186058-103186080 CATAGGACAGTGAGATTGCCTGG - Intergenic
1113409196 13:110069276-110069298 GAAATAAGAGTGAAGTTGGCCGG - Intergenic
1113551432 13:111195928-111195950 TATAGAACACTGAGGTTGCCAGG + Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1118352947 14:64987088-64987110 CATAGAACAGGTGAGGTGGCAGG + Exonic
1118692794 14:68356134-68356156 CATATAAAAGTTATGTTGGCCGG + Intronic
1120270479 14:82307804-82307826 CATAAAATAATAAAGTTGGCTGG - Intergenic
1120821546 14:88915908-88915930 CAGAGAAAAATGAATTTGGCTGG + Intergenic
1120864511 14:89284304-89284326 TATAGAACGGGGAAGGTGGCCGG - Intronic
1121811434 14:96894537-96894559 CACAGAACAGAGAAGCTGGAGGG - Intronic
1122495918 14:102155195-102155217 AAAAAAACAGTGAAGTAGGCAGG - Intronic
1123821010 15:24030605-24030627 CACAGAACAGTGAAATTGGGTGG + Intergenic
1125802445 15:42462194-42462216 CATAGCACAGTGTAGTTGCATGG + Intronic
1128424440 15:67525716-67525738 TAAAGAACAGTAATGTTGGCCGG + Intronic
1130210368 15:81916728-81916750 CATAGACCAATCAAGTTGTCAGG + Intergenic
1130217716 15:81987855-81987877 CATGTAACAGAAAAGTTGGCCGG - Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133249641 16:4472446-4472468 AATAAAAAAGTAAAGTTGGCCGG + Intronic
1136136097 16:28257862-28257884 CACACAGCAGTGAAGTGGGCAGG - Intergenic
1136162007 16:28426248-28426270 CATTGGACGGTGAGGTTGGCTGG + Intergenic
1136200959 16:28688742-28688764 CATTGGACGGTGAGGTTGGCTGG - Intronic
1136217299 16:28802926-28802948 CATTGGACGGTGAGGTTGGCTGG - Intergenic
1136863278 16:33715802-33715824 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1203124769 16_KI270728v1_random:1563953-1563975 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1144112595 17:12050782-12050804 CACAGAATATTGAAGTTGGAGGG - Intronic
1144389609 17:14780968-14780990 CATAGATCAGTGATGTGGCCTGG + Intergenic
1145804174 17:27714660-27714682 TATAGAACACTGAGGTTGCCAGG - Intergenic
1148915810 17:50977604-50977626 CAGAAAACAGTGAAACTGGCAGG + Intronic
1149109133 17:53005841-53005863 GATTGAACAGTGGAGTTGGAAGG + Intergenic
1149299178 17:55288442-55288464 CAGAAAACAGTGAAACTGGCCGG - Intronic
1150467670 17:65407920-65407942 CATAGGACAGTGGAGTTGTGGGG - Intergenic
1151568077 17:74911198-74911220 TATAGAACACTGAGGTTGCCAGG - Intergenic
1153438115 18:5088299-5088321 TATAGAACACTGAGGTTGCCAGG - Intergenic
1155476054 18:26236779-26236801 TATAGAACACTGAGGTTGCCAGG + Intronic
1158242988 18:55398478-55398500 CCTAGAACAGTGAAGTCACCAGG + Intronic
1162107976 19:8382312-8382334 TATAGAACAGTGAGGTTGCCAGG - Intronic
1162241565 19:9359159-9359181 CATATAAAAGTTACGTTGGCTGG + Intronic
1162987358 19:14279415-14279437 CATAGAACAGGATGGTTGGCCGG + Intergenic
1163234447 19:16022710-16022732 CATACATCAGTGAAGTAAGCAGG + Intergenic
1163661439 19:18580294-18580316 GATAGAACACTGAGGTTGCCAGG - Intronic
1164391840 19:27829928-27829950 TTTAAAACAGTAAAGTTGGCCGG - Intergenic
1164992889 19:32697239-32697261 TATAGAACACTGAGGTTGCCAGG + Intronic
1165644139 19:37419423-37419445 CATATAAAAGTTATGTTGGCTGG + Intronic
1165847147 19:38825565-38825587 TATAGAACACTGAGGTTGCCAGG - Intronic
1166872203 19:45877512-45877534 CATTCAACAGTAAAGTTGGGGGG - Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
925970393 2:9102755-9102777 CAAAGAACAGAGAAGTTTGGAGG + Intergenic
926656564 2:15413835-15413857 CAGAGAACAGTGATGTTGTTGGG - Intronic
927930860 2:27042994-27043016 CATAGGACAGTGATGCTGACAGG + Intronic
929678819 2:43967441-43967463 CATACCTCAGTAAAGTTGGCTGG + Intronic
930647013 2:53921570-53921592 TAAAGAAAACTGAAGTTGGCCGG + Intronic
930869241 2:56153439-56153461 CTTAGAGCAGTAGAGTTGGCTGG + Intergenic
931879938 2:66557981-66558003 CAAAGAAAAGGAAAGTTGGCTGG + Intronic
932119503 2:69085241-69085263 CATAGAGAACTGTAGTTGGCAGG - Intronic
932584979 2:73022071-73022093 CAGAGAACAGAGAATTAGGCTGG + Intronic
938806128 2:134808562-134808584 TATAGGACACTGAAGTTGCCAGG + Intergenic
939076015 2:137603463-137603485 CATTGAACAGTGTACTTGGAAGG + Intronic
942034680 2:171999614-171999636 CATGGAAACGTGAAGTTGGGCGG - Exonic
946207309 2:218119093-218119115 TATAGAACACTGAGGTTGCCAGG + Intergenic
1169286071 20:4308333-4308355 CTTAGAACTCTGATGTTGGCAGG + Intergenic
1170633047 20:18081584-18081606 GAAAGAACAGTGAAGTTGCAAGG - Intergenic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1171155337 20:22867183-22867205 GATAGAACAGTGAGGTTAGAAGG - Intergenic
1171261560 20:23738767-23738789 CATAGAACACCGAAGTTGGCAGG - Intergenic
1171270700 20:23814658-23814680 TATAGAACACTGAAGTTGCCAGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171373468 20:24676261-24676283 CTTAGACCAGTGAAGATGCCTGG + Intergenic
1172286946 20:33747317-33747339 CATAAAACAGTCATTTTGGCCGG + Intronic
1173766531 20:45615358-45615380 AAGAGAACAGTCAAGTGGGCAGG + Intronic
1176948543 21:15015240-15015262 AATAGATCAGTGAGGTTGCCTGG + Intronic
1182290839 22:29278388-29278410 CATTTAACAGTGAAATTGGCTGG + Intronic
1183027218 22:35074366-35074388 CATGGAACAGTGAAGTAGAAGGG - Intronic
949448925 3:4164708-4164730 TATAGAACACTGAGGTTGCCAGG + Intronic
950109655 3:10410823-10410845 CAGAGAACAGAGAGGTTGGCTGG + Intronic
952554993 3:34521461-34521483 TATAGAACACTGAGGTTGCCAGG + Intergenic
953490822 3:43348608-43348630 AATGGAACAGTGAAGTGAGCCGG - Exonic
954774825 3:53007313-53007335 GATACAACGGTGAAGGTGGCAGG - Intronic
956869740 3:73405105-73405127 CATAGTCCTGTGAAGTTGGCAGG + Intronic
957808039 3:85176787-85176809 CATATAACACTAGAGTTGGCAGG + Intronic
958075586 3:88673017-88673039 CATATAACAGTCAAGATGGAGGG + Intergenic
960063743 3:113349368-113349390 TATAGAACACTGAGGTTGCCAGG - Intronic
960537177 3:118827087-118827109 AATAGAAAAGGGAAGCTGGCAGG - Intergenic
962580031 3:136789906-136789928 AAGACAACAGTGAAGTAGGCTGG - Intergenic
962787608 3:138782806-138782828 CGTGGAACAGTTAAGTTGGATGG - Intronic
963023734 3:140898401-140898423 TATAGAAGAATGAAGATGGCAGG - Intergenic
963302796 3:143617731-143617753 GATAGATAAGTGAAGTAGGCTGG - Intronic
963409169 3:144907018-144907040 TATAGAACACTGAAGTTGCCAGG + Intergenic
967576537 3:191101357-191101379 CATCGAACAGTTAATTTGGCAGG + Intergenic
973638117 4:52878257-52878279 CATACAGCAGTGAAGGAGGCAGG + Intronic
975000816 4:69222150-69222172 TATAGAACACTGAGGTTGCCAGG + Intergenic
975004631 4:69270118-69270140 TATAGAACACTGAGGTTGCCAGG - Intergenic
975013051 4:69379098-69379120 TATAGAACACTGAGGTTGCCAGG - Intronic
976174268 4:82336190-82336212 TATAGAACACTGAGGTTGCCAGG + Intergenic
976610926 4:87029576-87029598 GATAGCACAGGGAAGTTGGATGG + Intronic
981113951 4:140968205-140968227 CATAGAACTGTAAACTGGGCTGG - Intronic
984542421 4:181056101-181056123 TATAAAAATGTGAAGTTGGCCGG - Intergenic
987296861 5:16561089-16561111 GAAAGAGAAGTGAAGTTGGCAGG + Intronic
991553860 5:67873543-67873565 TTTAAAACAGTGATGTTGGCAGG - Intergenic
992049404 5:72929162-72929184 TATAGAACACTGAGGTTGCCAGG - Intergenic
992107002 5:73457731-73457753 TATAGAACAGCGAAGGGGGCTGG + Intergenic
994996606 5:107071890-107071912 CATAGAATAGAAGAGTTGGCCGG + Intergenic
995583380 5:113622951-113622973 TATAGAACACTGAGGTTGCCAGG + Intergenic
996214572 5:120851163-120851185 CATTGAAAAGTGAATTTGGGAGG - Intergenic
996519676 5:124413095-124413117 GAAAGAACAATGAAGTTGGAGGG - Intergenic
1000822163 5:165998033-165998055 TCTAAAACAGTGAAGTTTGCAGG + Intergenic
1001741332 5:174055295-174055317 CATAGAAGTGGGGAGTTGGCTGG + Intronic
1003369889 6:5513951-5513973 GATACAACAGTGCATTTGGCTGG - Intronic
1004113710 6:12747150-12747172 CATAGAACAGTGAATCTGAAAGG + Intronic
1004402905 6:15305227-15305249 CATTGAAGATTGATGTTGGCCGG + Intronic
1006066899 6:31468611-31468633 CCTACAACAGGGAAGCTGGCTGG - Intergenic
1006802559 6:36768526-36768548 CACAGAACTGTGAATATGGCTGG - Intronic
1007597685 6:43061538-43061560 CATAGAACGGCGAAGCTGCCGGG - Exonic
1008586953 6:52959184-52959206 TATAGAACACTGAGGTTGCCAGG + Intergenic
1009385902 6:63083941-63083963 TATAGAACACTGAGGTTGCCAGG + Intergenic
1009407674 6:63330377-63330399 TATAGAACACTGAGGTTGCCAGG + Intergenic
1009872815 6:69470992-69471014 TATAGAACACTGAGGTTGCCAGG - Intergenic
1011994303 6:93565912-93565934 CATTAAAGAGTGAAGTCGGCCGG + Intergenic
1013977457 6:116093936-116093958 TATAGAACACTGAGGTTGCCAGG - Intergenic
1014914612 6:127131049-127131071 GATAGAACTGGAAAGTTGGCTGG - Intronic
1015759203 6:136639924-136639946 CACAGAATAGTGTAGTAGGCAGG - Intronic
1016104103 6:140140520-140140542 CGTAAAACAGTGCAGTAGGCCGG + Intergenic
1016184066 6:141179019-141179041 TATAGAACACTGAGGTTGCCAGG - Intergenic
1018737315 6:166696970-166696992 CAAAGATCTGTGCAGTTGGCAGG - Intronic
1022196077 7:28068667-28068689 CATAGAACAGAGAAATTAACAGG + Intronic
1023590026 7:41771827-41771849 CAGAGAAGTGTGCAGTTGGCAGG + Intergenic
1024505249 7:50157087-50157109 CAAGGAACAGTGCATTTGGCTGG + Intronic
1025319425 7:58078347-58078369 CAGAGAACAGTGAGGTGGCCAGG + Intergenic
1025868630 7:65409416-65409438 TTTAAAACAGTAAAGTTGGCTGG + Intergenic
1028318020 7:89428053-89428075 CCAAGAACAATAAAGTTGGCTGG + Intergenic
1030420543 7:109302052-109302074 TATAGAACACTGAGGTTGCCAGG - Intergenic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1036538808 8:9682234-9682256 TATAGAAAAGTGACGTAGGCCGG - Intronic
1036580656 8:10072065-10072087 GATAGAGCAATGAGGTTGGCAGG + Intronic
1037103018 8:15071496-15071518 CATAGCCCTGTGAAGTAGGCAGG - Intronic
1037780983 8:21868935-21868957 AATAGAAGAGGGAGGTTGGCCGG + Intergenic
1038878701 8:31582435-31582457 TATAGATCAGTGAAATGGGCAGG - Intergenic
1038977994 8:32723249-32723271 AAATGAACACTGAAGTTGGCTGG - Intronic
1039693148 8:39882638-39882660 TATAGAACACTGAGGTTGCCTGG + Intergenic
1040527734 8:48239404-48239426 TATAGAACATTGAGGTTGCCAGG - Intergenic
1040629468 8:49193233-49193255 CATAGTTCAGTGAAGGTGACAGG - Intergenic
1040965029 8:53074237-53074259 TATAGAACACTGAGGTTGCCAGG + Intergenic
1041605841 8:59781427-59781449 TCCAGAACAGTGTAGTTGGCTGG + Intergenic
1041680231 8:60581707-60581729 TTCAGAACAGTGAATTTGGCTGG + Intronic
1042919640 8:73908871-73908893 TATAGAACACTGAGGTTGCCAGG - Intergenic
1043517359 8:81007047-81007069 CATAGAGAAGTGAAGGGGGCAGG - Intronic
1044304811 8:90626922-90626944 CATAGAATGCTAAAGTTGGCCGG - Intronic
1045082766 8:98646715-98646737 GAAAGAAGAGTGAAGTTAGCTGG - Intronic
1045541584 8:103091594-103091616 CATATAAAAGTTATGTTGGCCGG + Intergenic
1045915879 8:107470452-107470474 CATAGAAAAATGAATTTGCCAGG - Intronic
1046042155 8:108918848-108918870 CATAGAACTGTGAAGTTGGAAGG + Intergenic
1048035966 8:130677341-130677363 CCTAGAACACTGAAGTAGACAGG - Intergenic
1049462115 8:142735069-142735091 CAGAAACCCGTGAAGTTGGCAGG - Intronic
1051386575 9:16515469-16515491 GATAGAACAGGGAAGAGGGCGGG - Intronic
1051438928 9:17062318-17062340 AATAGAACAGGGAAGGTGGTAGG + Intergenic
1052984515 9:34476702-34476724 CATAGAGCAGTGAAGTTAGATGG + Intronic
1053181021 9:35970183-35970205 TATAGAACAATGAAACTGGCTGG - Intergenic
1055752492 9:79522284-79522306 CACAGAACATAGAAGTTGGATGG + Intergenic
1057221155 9:93258690-93258712 AATAGAAAAGGAAAGTTGGCAGG - Intronic
1057277030 9:93681398-93681420 CCTATGACAGTGAAGTTGGGAGG + Intergenic
1059493993 9:114694443-114694465 CATACATCAGGGCAGTTGGCTGG + Intergenic
1185803391 X:3033555-3033577 CATATAACAGTGAACCTGGAGGG + Exonic
1189187879 X:39069988-39070010 CATTGAAAGGTGAAGTTGGCTGG - Intergenic
1189370852 X:40427890-40427912 CAAAAATCAGAGAAGTTGGCCGG - Intergenic
1191850168 X:65580500-65580522 CATAGCTCTGTGAAGTTGGCAGG - Intergenic
1192411483 X:70936890-70936912 CATTTAAGAGTGAAGTGGGCCGG - Intergenic
1196097739 X:111817648-111817670 CTGTGAACTGTGAAGTTGGCAGG + Intronic
1196419358 X:115506778-115506800 TATAGAACACTGAGGTTGCCAGG + Intergenic
1197025317 X:121740696-121740718 CATAGAAAAGAGAAATTTGCAGG - Intergenic
1198455048 X:136808710-136808732 CTTAAAACACTAAAGTTGGCTGG - Intergenic
1199102368 X:143817894-143817916 CATACAAGAATGAATTTGGCTGG + Intergenic
1199560482 X:149158073-149158095 CATAGAACAGAGTTGTAGGCTGG - Intergenic
1199832386 X:151559362-151559384 TATAGAACACCGAGGTTGGCAGG + Intergenic
1200808872 Y:7461609-7461631 CACAGAGCAATGAAGTTGGCTGG + Intergenic
1200835437 Y:7727205-7727227 CATAGAATAGTGCACTTGGAGGG + Intergenic
1201271920 Y:12263849-12263871 TATAGAACACTGAAGTTTCCAGG + Intergenic
1201455143 Y:14161090-14161112 TATAGAACACTGAGGTTGCCAGG - Intergenic
1201496375 Y:14594539-14594561 TATAGAACACTGAGGTTGCCAGG + Intronic
1201749928 Y:17421334-17421356 TATAGAACACTGAGGTTGCCAGG + Intergenic