ID: 1104077681

View in Genome Browser
Species Human (GRCh38)
Location 12:125404830-125404852
Sequence TTTGCTTTGGAGTGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104077681 Original CRISPR TTTGCTTTGGAGTGAAACAC TGG (reversed) Intronic
900881127 1:5382100-5382122 TTGGCTTTGGAATGCAGCACCGG + Intergenic
901534287 1:9872392-9872414 TTTGCTCTGGGGTGATTCACAGG - Intronic
904047897 1:27619786-27619808 TTTGCTAAGGCGGGAAACACAGG - Intronic
905089742 1:35420029-35420051 GTAGCTTTGGAGTGAAACTTTGG + Exonic
905177793 1:36148883-36148905 TTAGCTTTGGAGTTAAACACGGG + Intronic
906190623 1:43897440-43897462 TTGGCTTTGGAGTCAAATACTGG - Intronic
907970460 1:59375922-59375944 TGTGCTTTGGCTTGAAGCACTGG + Intronic
908787358 1:67748438-67748460 TTTTCTCTTCAGTGAAACACAGG + Intronic
909566750 1:77061147-77061169 TATGTTCTGTAGTGAAACACTGG - Intronic
911365983 1:96937752-96937774 TTTTCTTTGGTGAGAAACCCTGG - Intergenic
911419004 1:97615743-97615765 CTTGCTAAGGAGTGAAACACTGG - Intronic
911460443 1:98182419-98182441 TTTTTTTTGTAGGGAAACACAGG - Intergenic
911699099 1:100929797-100929819 TTTGTTTTGCAATGAAAAACAGG + Intronic
916894104 1:169143497-169143519 ATTGCTGTGTAGTGAAAGACAGG - Intronic
917598464 1:176552822-176552844 AGTGCTTTGGAGTGAAAAAAAGG + Intronic
918372407 1:183874351-183874373 TTAGCTTGGGAATGAAAGACAGG + Intronic
918793772 1:188865293-188865315 TTTTCTTTGGCGTCAGACACTGG + Intergenic
920011677 1:202872526-202872548 TTTGCCTTGGAGAGAAACAATGG - Intergenic
920143604 1:203839411-203839433 TATGACTTGCAGTGAAACACTGG + Intronic
920232852 1:204481898-204481920 TTTTCTCTGGATTGAAAGACTGG - Intronic
921299517 1:213737012-213737034 TTTGCTCTGTGGTGGAACACGGG - Intergenic
921609531 1:217194792-217194814 TTTGCTTTGGAGTGAGAAATGGG + Intergenic
922707626 1:227797589-227797611 TTTGCTGGGGAGATAAACACAGG + Intergenic
923618536 1:235557822-235557844 TCTGCTATGGAGTGGAACATGGG - Intronic
924312853 1:242763851-242763873 TTTGCCTTGGACTCCAACACTGG + Intergenic
924808574 1:247381313-247381335 TTTGCCTTGCAATGAAACGCAGG - Intergenic
1063111745 10:3044165-3044187 TTTGGATTGGAGTGAGACACAGG + Intergenic
1063208452 10:3856618-3856640 GTTGCTTGGCAATGAAACACCGG - Intergenic
1065299426 10:24307908-24307930 TTTGCGATGGAGAGAAACAAAGG + Intronic
1068180424 10:53511501-53511523 ATTGCTTGGGGCTGAAACACTGG + Intergenic
1070061447 10:72987293-72987315 TTTTTTTTTCAGTGAAACACAGG - Intergenic
1070423564 10:76262742-76262764 TTTGCTTTGGGGAAAAAAACAGG - Intronic
1070685759 10:78479478-78479500 TTTTCTTTAGAGTGTAACACAGG + Intergenic
1072317718 10:94219953-94219975 TTTGCTTAGGAGAGACACAGAGG - Intronic
1072585077 10:96774449-96774471 TTAGCTTTGGCCTGGAACACAGG + Intergenic
1072633128 10:97160592-97160614 TTCTCTTTGGTGTGAAACGCTGG - Intronic
1073380224 10:103072555-103072577 TTTGTTTTGGAGTGAACACCCGG + Intronic
1073955293 10:108863912-108863934 TTTGTTTTGATGTGTAACACTGG - Intergenic
1075929237 10:126281019-126281041 TTTGCTTTCGAGTCCATCACAGG + Intronic
1076570633 10:131430442-131430464 TGTCCATTGGAGTGAAAAACGGG - Intergenic
1080505310 11:32906860-32906882 TTTGCTTTGAAATGATACATGGG - Intronic
1080570477 11:33551878-33551900 TTTGCATTGGAGGGAATCTCTGG + Intronic
1081163536 11:39782113-39782135 TTTGATTTTAAATGAAACACAGG + Intergenic
1081402805 11:42662292-42662314 GTTGCTTTGGAGTGAAGCAAAGG - Intergenic
1081783533 11:45730294-45730316 TTTGCCTTGAGGTGAAACCCTGG - Intergenic
1085818587 11:79768494-79768516 TTTGGTTTGTTGTGATACACAGG + Intergenic
1090648422 11:128785320-128785342 TTTGCTTTGGAGCCTAGCACTGG + Intronic
1091420408 12:334642-334664 TGTGCTTTGGAGTAAACCAGAGG - Intronic
1093645548 12:21581881-21581903 TTTAGTTTGGAGGGAAAGACAGG + Intronic
1095691704 12:45096509-45096531 TTTCCTTTGGTCTGAAACACTGG - Intergenic
1095753524 12:45736909-45736931 TTTACTGTGGGGTGAAACACTGG - Intronic
1099692206 12:85970708-85970730 TTTGCTTTGAAGTCAAATAGAGG + Exonic
1099861237 12:88228115-88228137 TGTCCTTTGGAGTGGAAGACAGG - Intergenic
1102658579 12:114504866-114504888 TTTGCTTTGGAACAAAACTCAGG + Intergenic
1104077681 12:125404830-125404852 TTTGCTTTGGAGTGAAACACTGG - Intronic
1104435033 12:128748882-128748904 CTTGCTCTGGAGGGAAACAGAGG + Intergenic
1113148099 13:107231165-107231187 TTTGCTTTGAAATGAAAAATTGG + Intronic
1113228814 13:108189794-108189816 TCTGATTTGGGGTTAAACACCGG - Intergenic
1115510085 14:34130245-34130267 TTTCTTTAGGAGTGAAATACAGG + Intronic
1116799738 14:49429965-49429987 TGTGCTTTTCAGGGAAACACAGG - Intergenic
1118073585 14:62272914-62272936 TTTGCTGTGTAGAGAAGCACAGG - Intergenic
1118866208 14:69705638-69705660 TTTGGTTTGGAATGGAACCCTGG + Intronic
1118904332 14:70012616-70012638 GTTGCTTTGGAGAGGAGCACTGG + Intronic
1120226867 14:81800609-81800631 TTGGATTTGAACTGAAACACTGG - Intergenic
1120679418 14:87462289-87462311 TTTGGTTTTGGGTGAAACAGAGG - Intergenic
1122111861 14:99508851-99508873 GTGGCTGTGGAGTGACACACAGG + Exonic
1124044086 15:26131885-26131907 TATGCATTTGAGTGAAATACAGG - Intergenic
1125517859 15:40332817-40332839 ATGGCTTTGGAGTGTGACACTGG - Intronic
1125982441 15:44015022-44015044 TTTCTTTTGGGGTGAAAAACAGG - Intronic
1126718546 15:51550315-51550337 TATGCCTTTGAGTGAAAAACTGG - Intronic
1127669724 15:61183778-61183800 TTTGCTTTGTGGAAAAACACAGG - Intronic
1128773058 15:70297224-70297246 TTTGCTTTGGAAAGAAGCACAGG + Intergenic
1128818737 15:70633447-70633469 TTTGCTTTGATGGGAAAGACAGG - Intergenic
1129413123 15:75360740-75360762 TTTGCTTTGGTGTGGAAGAAGGG - Intronic
1137850802 16:51740460-51740482 TTAGCTTTGGAGTAAAACCCAGG + Intergenic
1138188019 16:54991561-54991583 TTGGATTTGAACTGAAACACTGG - Intergenic
1138338155 16:56269035-56269057 TGTGCATGGGAGTGAAGCACTGG + Intronic
1138451801 16:57097731-57097753 TTTGCCTAGGACTGAAAGACTGG - Intronic
1139153780 16:64416101-64416123 TTTGCATTGAAGTGCAAGACTGG - Intergenic
1140519723 16:75570631-75570653 TCTGCCTTGGAGTGGAAAACAGG + Intronic
1140587234 16:76307906-76307928 TTTCATTTGGAGGCAAACACTGG - Intronic
1143435430 17:6921076-6921098 TTTGGGCTGGAGTGGAACACGGG + Intronic
1146171219 17:30635131-30635153 TTGGCTTTGGAGAGATTCACAGG - Intergenic
1146344679 17:32051140-32051162 TTGGCTTTGGAGAGATTCACAGG - Intronic
1153198847 18:2629338-2629360 TTTACTTTGGAGTGATGCCCTGG - Intergenic
1155087049 18:22468788-22468810 CTTGCTATGGTGTTAAACACAGG + Intergenic
1155469927 18:26180747-26180769 TTTGCTTTTGAGTGATAGAATGG + Intronic
1155555960 18:27019670-27019692 TTTGCCATGTAGTGAAACAGTGG - Intronic
1155866866 18:30976018-30976040 ATTGCTTTGGATTGAGACACAGG - Intergenic
1156264987 18:35480062-35480084 TGTGCTGTGGAGTAGAACACAGG - Intronic
1157124156 18:44938897-44938919 TTTTCTTTCCAGTGAAACATAGG - Intronic
1158042194 18:53108297-53108319 CTTCCTTTGGTGTGAAACATAGG - Intronic
1158536182 18:58309938-58309960 TATGCTTTGGAGTTAAAGCCAGG + Intronic
1159320214 18:66838563-66838585 CTTGCTCTGGAGTGAAACAGGGG + Intergenic
1161855928 19:6765442-6765464 TTTGCTTTAGAATGCAACGCTGG + Intronic
1161915234 19:7223423-7223445 TCTGCTTTGGGGTGAAACGCAGG + Intronic
926469782 2:13239411-13239433 TTTGATTTGAAGTAAAAGACGGG + Intergenic
926762280 2:16288637-16288659 TTTGCTTTGGAAATAAGCACAGG + Intergenic
929038229 2:37717450-37717472 TTAGCTTTGGAGTAAAAAGCTGG + Intronic
929943825 2:46355370-46355392 TAGGCTTTGGAGTTAAACACAGG - Intronic
932533228 2:72561505-72561527 TTTCCTTTTGAGTGAAACTATGG - Intronic
934116321 2:88798950-88798972 ATTGCTTTTGACTCAAACACTGG - Intergenic
934626835 2:95865894-95865916 ATTGCTTTTGACTCAAACACTGG + Intronic
934806723 2:97235396-97235418 CTTGCTTTTGACTCAAACACTGG - Intronic
934830786 2:97521779-97521801 ATTGCTTTTGACTCAAACACTGG + Intronic
941052573 2:160751177-160751199 TTTCCTTCGGTGTGAACCACTGG + Intergenic
941052645 2:160751798-160751820 TTTCCTTCGGTGTGAAACACTGG + Intergenic
942235517 2:173900297-173900319 TGTGTTTTGGAGTGATACTCTGG + Intergenic
942959088 2:181808105-181808127 TTTTCTTTGAAGGAAAACACAGG - Intergenic
943941870 2:194008784-194008806 TTTGCTTTGGTACCAAACACTGG + Intergenic
944616844 2:201469358-201469380 TGTGCTTTGGAGTGAGAGTCAGG - Intronic
944940590 2:204620978-204621000 TTTACATTACAGTGAAACACAGG - Intronic
945351288 2:208784227-208784249 TTTGATGTGGATTGAAACTCAGG + Intronic
948062545 2:235052334-235052356 TGGGCTTTGGAGGGAGACACTGG + Intronic
1172136854 20:32692430-32692452 CATGCTTTGGAATGCAACACTGG + Intergenic
1179232706 21:39519545-39519567 GTGGCTTTGGAGTGGGACACAGG - Intergenic
1180133966 21:45848739-45848761 TTTGCTTTGGACTGCAGCGCTGG + Intronic
1180216622 21:46327633-46327655 TTTGCTTTGTAATGGAAGACTGG + Intronic
1182181196 22:28350449-28350471 TTTGCTTTGGGGTCAATCACAGG + Intronic
1182510289 22:30814935-30814957 TGGGATTTGGAGTCAAACACAGG - Intronic
1184809053 22:46816262-46816284 TTTGGTTTGGAGGGTATCACAGG + Intronic
949355628 3:3177898-3177920 TTTTATTTGTAGGGAAACACTGG - Intronic
951133771 3:19078987-19079009 TTTGCTTTAGATTTAAACATGGG + Intergenic
952731059 3:36636896-36636918 TTTGCTGAGGACTGAAAAACTGG - Intergenic
956351199 3:68338273-68338295 ATTGCTTTGGAATTAAATACAGG - Intronic
957014042 3:75043062-75043084 TTTGTTTGGTAGTGAAACTCAGG + Intergenic
957248631 3:77744803-77744825 TTGGCTCTGGAGTGAGAGACAGG - Intergenic
957310018 3:78507531-78507553 TTTGCTTTGAAGTCTGACACAGG + Intergenic
957340041 3:78883908-78883930 CTAGCTTTGCAGTGAAACATTGG - Intronic
957691927 3:83581754-83581776 TTTGTCATGGTGTGAAACACAGG + Intergenic
959058247 3:101590205-101590227 TTTTCTTTAGAGTGAACCAGAGG + Exonic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
960257475 3:115526330-115526352 TTTGATTTGGTGTGTCACACTGG + Intergenic
962948673 3:140198040-140198062 ATTGCTTTTGCTTGAAACACTGG - Intronic
963208327 3:142659372-142659394 TTTGCTTTGTAAAGAAACATAGG + Intronic
964799501 3:160539571-160539593 TTTGCTTTAGTGTGAACCATTGG - Intronic
965326051 3:167305781-167305803 CTTGCTTTCAAGTGATACACAGG + Exonic
971066246 4:23036090-23036112 TTTGCTCTGGAGTGGAGCAGGGG - Intergenic
971103974 4:23501036-23501058 CTTGCTTTGGAATGGAACTCTGG + Intergenic
971539769 4:27801255-27801277 TTTGCTCTGGAGTTTTACACTGG + Intergenic
972296501 4:37744227-37744249 TTGGCCTTGGTGAGAAACACAGG + Intergenic
973981723 4:56313622-56313644 TTTGCTTTGCAGTGGAAAAGTGG + Intronic
974262004 4:59537718-59537740 ATTGCTCTGGAGTAAAACACAGG - Intergenic
974652973 4:64778795-64778817 TTTTTTTTGTAATGAAACACTGG - Intergenic
974783941 4:66592775-66592797 TTTGATTTTGGGGGAAACACTGG - Intergenic
975721159 4:77249899-77249921 TATACTTGGTAGTGAAACACTGG - Intronic
976223565 4:82777795-82777817 TTTGTTTTGGTTTTAAACACTGG - Intronic
977311744 4:95396290-95396312 TTTGCTTTAAAGTGAAAAGCAGG - Intronic
977358734 4:95978795-95978817 TTTACTTTGCAGTAAAACAGGGG - Intergenic
977724063 4:100273819-100273841 TTTACTTTACGGTGAAACACTGG + Intergenic
977886551 4:102258351-102258373 TCTGCTTGGGAGTGAAGGACTGG + Intronic
984687961 4:182692777-182692799 ATTACTTAGGTGTGAAACACTGG + Intronic
986002885 5:3643867-3643889 TTTGCTTTGCACTAAAACATAGG + Intergenic
987039469 5:14048126-14048148 TTTGCTTTGGGGAGAAAAAGTGG + Intergenic
987839205 5:23200722-23200744 TTTTCTTTGTACTGAAAAACAGG - Intergenic
989695023 5:44190188-44190210 TCTGCTTTGGAGGGGACCACTGG + Intergenic
989713581 5:44431535-44431557 TTTCCTCAGGAATGAAACACTGG + Intergenic
990087067 5:51992148-51992170 TATGCTTAGGAGTGAAATGCTGG - Intergenic
990547200 5:56835021-56835043 GTTCCATTGGAGAGAAACACTGG - Intronic
990880456 5:60532094-60532116 TTTCCTTAGGAGTGAAAAGCTGG - Intergenic
993018122 5:82560257-82560279 TAAACTTTGCAGTGAAACACTGG + Intergenic
994146262 5:96399246-96399268 TTTGCTGTGGAGTCAAATTCAGG + Intronic
994850214 5:105045458-105045480 ATGGCTTTGTAGTGAAACCCAGG + Intergenic
995641775 5:114265513-114265535 TTTGATTCTGACTGAAACACTGG - Intergenic
995814896 5:116157189-116157211 TTGGTTTTGGAGTTAAACAGTGG - Intronic
997424460 5:133793789-133793811 TCTGATTTGGAGGGAACCACAGG + Intergenic
997996961 5:138594666-138594688 TTAGGCTTGTAGTGAAACACAGG + Intergenic
998687660 5:144547940-144547962 TTAACTATGGAGAGAAACACTGG - Intergenic
999717024 5:154369524-154369546 TTTCCTTTGGTTGGAAACACCGG + Intronic
1001712552 5:173790149-173790171 TTTCCTATGGAGGGAGACACTGG - Intergenic
1004018748 6:11757153-11757175 TTTCTTTTGTAGGGAAACACTGG - Intronic
1004459807 6:15825375-15825397 TCTGTTTTGGAGGGAAACTCAGG - Intergenic
1004669335 6:17781074-17781096 TTTGCTTTGGGGAAAAAGACCGG - Intronic
1004754630 6:18598529-18598551 CTTGCTTTTGATTGAACCACAGG + Intergenic
1007920106 6:45599696-45599718 CTTGCTTTGGAGTGAAGTGCAGG + Intronic
1011526402 6:88270012-88270034 TTTGGTTTGGAATGGAACAGTGG - Intergenic
1012472557 6:99588632-99588654 CTTCCTTTGGAGAGAGACACTGG + Intergenic
1013211399 6:107990097-107990119 TTTGCATAGGTGTGAAAAACTGG - Intergenic
1013268424 6:108522827-108522849 TTTGTTTTGAATTGAAACATAGG - Exonic
1013822561 6:114173037-114173059 TTTGCTTTGGAATGTTAAACAGG + Intronic
1014678194 6:124394624-124394646 TTGGGTTTGGACTGAAATACTGG - Intronic
1014730720 6:125028718-125028740 TTCTCTTTTAAGTGAAACACAGG - Intronic
1015436837 6:133199526-133199548 TTTCCTTTGGAGTGGAACCAAGG + Intergenic
1015470769 6:133603587-133603609 TTGCCTTTGAACTGAAACACTGG - Intergenic
1017153398 6:151301552-151301574 TTTGATTTGGAGTGAAATAAAGG + Intronic
1017590029 6:155968694-155968716 TTTCCTTTGGAGGGAAGCACAGG - Intergenic
1018016388 6:159716024-159716046 TTTGCTTTATTGTGAAACAAGGG + Intronic
1018284362 6:162221081-162221103 AATGCTTTGGTGTGAAAGACTGG + Intronic
1018843621 6:167538194-167538216 TTTGTTTTAGAGTGAGAGACGGG + Intergenic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1019859197 7:3641776-3641798 TCTGCTTGCGAGTGAAGCACCGG - Intronic
1024037519 7:45521168-45521190 TTTTTTTTTAAGTGAAACACAGG + Intergenic
1024391004 7:48812200-48812222 TTAGCTTTGTAGAGAAACATGGG - Intergenic
1026685257 7:72504339-72504361 TTTGAAGTGGATTGAAACACGGG + Intergenic
1030336741 7:108336953-108336975 TTTGCATTATAGTGAAAAACTGG + Intronic
1032648856 7:133856107-133856129 TGGGCTTTGGAATGAGACACAGG + Intronic
1033524249 7:142194749-142194771 TTTGTTTTGGTGTGAAAAATTGG + Intronic
1034143543 7:148847362-148847384 TTTGCTGCGGATTAAAACACAGG - Intronic
1034909120 7:154978273-154978295 TTTTCATAGTAGTGAAACACTGG - Intronic
1037709471 8:21344023-21344045 TTTGCTCTGGTCTGAAGCACGGG - Intergenic
1042239981 8:66654134-66654156 TAAGCTTTGGACTGATACACAGG - Intronic
1043976761 8:86593412-86593434 GTTTCTTTGGAGTGAAAACCAGG + Intronic
1044464386 8:92486489-92486511 TCTTCTTTGGAGGGAGACACTGG + Intergenic
1045264965 8:100611287-100611309 TTTGCTTTGCAATGCATCACTGG - Intronic
1046523027 8:115349891-115349913 TAGGCTTTGGGGTTAAACACAGG + Intergenic
1047210428 8:122836000-122836022 TGTCCTTTGGAGTGGAAGACTGG + Intronic
1047849728 8:128843506-128843528 TTTGCTTTGGCCTATAACACTGG + Intergenic
1048721055 8:137325689-137325711 TTTGCTTTTGAGTGAAAGAGAGG + Intergenic
1048752193 8:137691605-137691627 TTTGCATTGGAGTGAAAAAGTGG - Intergenic
1049100163 8:140573586-140573608 TGTGCATTTTAGTGAAACACGGG + Intronic
1049845145 8:144797095-144797117 TTTGCTCAGGAGTGAGGCACAGG - Intergenic
1051166959 9:14273150-14273172 TTTGCTGTGGAGTTTAAAACTGG - Intronic
1051693497 9:19742916-19742938 TTTTGTTTGGAGGGAAACAATGG + Intronic
1051994928 9:23203479-23203501 TTTGCTAAAGAATGAAACACAGG + Intergenic
1053542889 9:38993357-38993379 TTAGCATGGGAGTGAAGCACTGG + Intergenic
1053807333 9:41816874-41816896 TTAGCATGGGAGTGAAGCACTGG + Intergenic
1054623259 9:67370553-67370575 TTAGCATGGGAGTGAAGCACTGG - Intergenic
1056150966 9:83787877-83787899 TTTGATTTGTAGTGCAACTCTGG + Intronic
1056675826 9:88676290-88676312 GTTGTGTTGGAATGAAACACAGG - Intergenic
1058666121 9:107317567-107317589 TTTGTTTTAGAGTGAAATATAGG + Intronic
1060371243 9:123074021-123074043 TTTACTTTGGAGAGAAAAACAGG + Intronic
1062490351 9:136802342-136802364 TCTGCTTTGAAGTGAAACAGAGG - Intronic
1188339727 X:28984381-28984403 GTTGCTTTGTAGTGTGACACTGG - Intronic
1188645252 X:32558626-32558648 TTTGCTTTTATGTGAAACTCTGG - Intronic
1189931393 X:46015831-46015853 TTTACTTTGGTATGAATCACAGG + Intergenic
1191679756 X:63829099-63829121 TTTGCCTTAGACTGGAACACTGG - Intergenic
1194444117 X:93966331-93966353 TTTGCTTTGAGGTGAAGGACGGG - Intergenic
1195050890 X:101095970-101095992 TCTGTTTGGCAGTGAAACACTGG - Exonic
1196887546 X:120262431-120262453 ATTTCTTTGGAGTGAAATAATGG - Intronic
1199282420 X:146017648-146017670 TTTGTTTTGAGGGGAAACACAGG + Intergenic