ID: 1104081315

View in Genome Browser
Species Human (GRCh38)
Location 12:125432760-125432782
Sequence ACCAAGGCCGGCCCATCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104081315_1104081323 14 Left 1104081315 12:125432760-125432782 CCCTTTGATGGGCCGGCCTTGGT 0: 1
1: 0
2: 0
3: 10
4: 299
Right 1104081323 12:125432797-125432819 GTATCTGTTGGTGTGATGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1104081315_1104081322 2 Left 1104081315 12:125432760-125432782 CCCTTTGATGGGCCGGCCTTGGT 0: 1
1: 0
2: 0
3: 10
4: 299
Right 1104081322 12:125432785-125432807 AATCGGCATCTGGTATCTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1104081315_1104081320 -8 Left 1104081315 12:125432760-125432782 CCCTTTGATGGGCCGGCCTTGGT 0: 1
1: 0
2: 0
3: 10
4: 299
Right 1104081320 12:125432775-125432797 GCCTTGGTGGAATCGGCATCTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104081315 Original CRISPR ACCAAGGCCGGCCCATCAAA GGG (reversed) Intronic
901937357 1:12636056-12636078 ACCAAGGCAGGCGGATCACAAGG - Intergenic
902086297 1:13865455-13865477 GCCAAGGCCGGCGGATCACAAGG + Intergenic
903068384 1:20714091-20714113 GCCAAGGCAGGCACATCACAAGG + Intronic
903512384 1:23885953-23885975 ACCAAGGCAGGCAGATCACAAGG + Intronic
904065426 1:27746486-27746508 GCCAAGGCGGGCGCATCACAAGG + Intronic
904201644 1:28823626-28823648 ACCAAGGCAGGCGGATCACAAGG - Intronic
905193003 1:36250444-36250466 ACCAAGGCGGGCGGATCACAAGG - Intronic
906459283 1:46025027-46025049 ACCACGTCCGGCCCATCTGATGG - Intronic
907176159 1:52524571-52524593 GCCAAGGCAGGCAGATCAAAAGG + Intronic
907778365 1:57541361-57541383 ACCAAGGCAGGCAGATCACAAGG - Intronic
909626232 1:77719124-77719146 GCCAAGGCGGGCCGATCATAAGG + Intronic
909976701 1:82053868-82053890 GCCAAGGCTGGCACATCACAAGG - Intergenic
910278906 1:85476691-85476713 TCACAGGCCTGCCCATCAAAGGG + Intronic
910577277 1:88778955-88778977 ACCAAGGCGGGCGGATCACAAGG - Intronic
911566551 1:99469092-99469114 ACCAAGGCCGGCGGATCACGAGG - Intergenic
912168475 1:107068932-107068954 GCCAAGGCGGGCCGATCACAAGG + Intergenic
916750358 1:167718041-167718063 GCCAAGGCCGGCGGATCACAAGG - Intergenic
918626146 1:186658067-186658089 ACCAAGGCAGGCGGATCACAAGG - Intergenic
924353580 1:243145505-243145527 ACCAAGGCGGGCGGATCACAAGG - Intronic
1065002606 10:21350801-21350823 ACCAAGGCAGGCAGATCACAAGG + Intergenic
1066977787 10:42385420-42385442 CCCAAGGCCCTCCCATTAAAGGG - Intergenic
1068280542 10:54863306-54863328 ACCAAGGCGGGCAGATCACAAGG + Intronic
1069160765 10:65090076-65090098 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1070841296 10:79489847-79489869 ACCAAGGCGGGCAGATCACAAGG - Intergenic
1073247479 10:102101840-102101862 ACCAAGGCGGGCGGATCACAAGG - Intergenic
1073554777 10:104438662-104438684 ACCGCGCCCGGCCCATCAATGGG + Intronic
1074551083 10:114443070-114443092 ACCAAGGCGGGCAGATCACAAGG - Intronic
1074698796 10:116075079-116075101 AGTAAGGCCAGCCCATCAGAAGG - Intronic
1075010923 10:118869487-118869509 ACCAAGGCGGGCGGATCACAAGG + Intergenic
1078611016 11:12819683-12819705 ACCGAGGCGGGCGGATCAAAAGG - Intronic
1079309811 11:19355445-19355467 GCCAAGCCCTGCCCTTCAAAGGG + Intronic
1079422453 11:20306559-20306581 ACAAAGCCTGGCACATCAAAGGG + Intergenic
1079644189 11:22843174-22843196 ACCATGCCTGGCCCAACAAAGGG - Intergenic
1079959541 11:26906073-26906095 CCCAAGGTTGGCGCATCAAATGG + Intergenic
1081131345 11:39383887-39383909 ACCAAGGCAGGCAGATCAGAAGG + Intergenic
1081162560 11:39767777-39767799 ACCAAGGCAGGCAGATCACAAGG + Intergenic
1081271777 11:41093855-41093877 ACCAAGGCGGGCGGATCACAAGG + Intronic
1082040901 11:47684016-47684038 ACCAAGGCGGGCAGATCACAAGG + Intronic
1082278932 11:50248847-50248869 ACCAAGGCAGGCAGATCACAAGG + Intergenic
1082781569 11:57292350-57292372 ACCACGCCCGGCCGATAAAATGG - Intergenic
1082931291 11:58608835-58608857 GCCAAGGCGGGCAGATCAAAAGG - Intronic
1083332758 11:61906560-61906582 ACCAAGGCCGGGCCCCGAAAGGG - Exonic
1083438476 11:62659766-62659788 ACCAAGGCCGGCAGATCACAAGG + Intronic
1084100677 11:66946394-66946416 ACCAAGGCGGGCAGATCACAAGG + Intronic
1084316750 11:68350058-68350080 ATCTAGGCCGGCCCCTCAACCGG - Intronic
1084921463 11:72474000-72474022 ACCAAGGCAGGCAGATCACAAGG - Intergenic
1085667886 11:78431782-78431804 GCCAAGGCCGGCAGATCACAAGG - Intergenic
1086479909 11:87223402-87223424 ACCAAGGCAGGCAGATCACAAGG - Intronic
1087402821 11:97689121-97689143 ACCAAGCCTGGCCCATTGAAAGG - Intergenic
1088993973 11:114979948-114979970 CCCCAGGCAGGCCCATCAAGAGG + Intergenic
1089629422 11:119774868-119774890 CCCAATGGGGGCCCATCAAAGGG - Intergenic
1090241958 11:125190156-125190178 ACCAAGGCGGGCCAATCACAAGG - Intronic
1092829190 12:12427412-12427434 GCCGAGGCGGGCCCATCACAAGG - Intronic
1093227295 12:16500869-16500891 ACCAAGGCAGGCGGATCACAAGG + Intronic
1093758052 12:22874669-22874691 GCCAAGGCCGGCGGATCACAAGG - Intergenic
1095405468 12:41862423-41862445 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1096160984 12:49376948-49376970 ACCAAGGCAGGCGGATCACAAGG - Intronic
1096627089 12:52902620-52902642 GCCAAGGCGGGCCAATCACAAGG - Intronic
1098310156 12:69140431-69140453 ATCAAGGACGGTCAATCAAAGGG - Intergenic
1098899450 12:76097958-76097980 ACCAAGGCGGGCAGATCACAAGG + Intergenic
1098969324 12:76833501-76833523 ACCATGCCCGGCCAATTAAAGGG - Intronic
1101325773 12:103714463-103714485 ACCAAGGCAGGCAGATCATAAGG + Intronic
1101898810 12:108775831-108775853 ACCAATGCAACCCCATCAAAGGG + Intergenic
1103431631 12:120892746-120892768 ACCAAGGCGGGTGCATCACAAGG + Intronic
1104081315 12:125432760-125432782 ACCAAGGCCGGCCCATCAAAGGG - Intronic
1104350945 12:128043534-128043556 AACAAGGCGAGGCCATCAAAGGG - Intergenic
1105307694 13:19180727-19180749 GCCAAGGCGGGCATATCAAAAGG - Intronic
1106969415 13:35119821-35119843 ACCAAGGCAGGCAGATCACAAGG - Intronic
1108578770 13:51811250-51811272 ACCAAGGCGGCCCCCACAAAAGG + Intergenic
1109604182 13:64670822-64670844 GCCAAGGCGGGCAGATCAAAAGG - Intergenic
1110830440 13:80024982-80025004 ACCAAAGCAGGACCAGCAAAAGG + Intergenic
1110938596 13:81321538-81321560 GCCAAGGCCGGCAGATCACAAGG - Intergenic
1113329486 13:109314719-109314741 ACCAAGGCGGGCGGATCACAAGG - Intergenic
1114212784 14:20630048-20630070 AGAAAGGCCTGCCCCTCAAAAGG - Intergenic
1117677561 14:58170365-58170387 ACCAAGGCGGGCAGATCACAAGG + Intronic
1118041596 14:61922813-61922835 GCCAAGGCAGGCCGATCACAAGG + Intergenic
1118313787 14:64711644-64711666 GCCAAGGCAGGCGCATCACAAGG - Intronic
1118402268 14:65390958-65390980 GCCAAGGCAGGCCGATCAAGAGG - Intergenic
1118730141 14:68660127-68660149 AAGAAGGCTGGCCCATCTAAAGG + Intronic
1119069213 14:71564721-71564743 ACCAAGGCGGGCGGATCACAAGG - Intronic
1121761756 14:96451006-96451028 ACCAAGGCGGGCAGATCACAAGG - Intronic
1122222456 14:100248919-100248941 ACCAAGGCGGGCCGATCATGAGG - Intronic
1123846903 15:24312268-24312290 ACCAAGGCAGGCAGATCATAAGG + Intergenic
1124926198 15:34072881-34072903 GCCAAGGCAGGCGGATCAAAAGG - Intergenic
1124941791 15:34225143-34225165 ACCGAGGCCGGCGCTTCAAGTGG + Exonic
1126079945 15:44950015-44950037 ACCAAGGCGGGCTGATCACAAGG + Intergenic
1126132361 15:45354226-45354248 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1126162285 15:45624946-45624968 ACCAAGGCGGGCGGATCACAAGG + Intronic
1126632046 15:50746203-50746225 GCCAAGGCGGGCAGATCAAAAGG + Intronic
1128117915 15:65123473-65123495 ACCATGCCCGGCCCTTCAACAGG + Intronic
1128346251 15:66854362-66854384 ACCAAGGCTGTCCCAGGAAAGGG + Intergenic
1132481148 16:166710-166732 ACCAAGGCCTGCGCAGCACAGGG - Exonic
1132789830 16:1679404-1679426 ACCACGCCCGGCCAATCTAAAGG - Intronic
1132938595 16:2495543-2495565 GCCAAGGCAGGCACATCACAAGG + Intronic
1133828471 16:9300192-9300214 GCCAAGGCAGGCACATCACAAGG - Intergenic
1134002933 16:10796725-10796747 ACCGCGCCCGGCCCATAAAAGGG + Intronic
1136709168 16:32220269-32220291 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1136758742 16:32709150-32709172 ACCAAGGCAGGCGGATCACAAGG + Intergenic
1136809366 16:33161229-33161251 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1136815842 16:33271309-33271331 ACCAAGGCAGGCGGATCACAAGG - Intronic
1139928790 16:70508151-70508173 ACCAAGGCAGGCGGATCACAAGG - Intronic
1140091055 16:71839266-71839288 GCCAAGGCCGGCAGATCACAAGG - Intergenic
1140797439 16:78452709-78452731 GCCAAGGCAGGCCGATCACATGG - Intronic
1140798868 16:78466263-78466285 GCCAAGGCAGGCTGATCAAAAGG - Intronic
1141462188 16:84184162-84184184 TCCCAGGCCAGCCCAGCAAAGGG - Intronic
1142348422 16:89568854-89568876 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1203060896 16_KI270728v1_random:969481-969503 ACCAAGGCAGGCGGATCACAAGG + Intergenic
1142854118 17:2720619-2720641 ACCACGCCCGGCCCATCTGAGGG + Intergenic
1144546402 17:16200251-16200273 GCCAAGGCCGGCGGATCACAAGG + Intronic
1145299974 17:21627054-21627076 GCCAAGGCCGGCAGATCACAAGG - Intergenic
1145314159 17:21719175-21719197 ATCCAGCCCAGCCCATCAAAAGG - Intergenic
1145350311 17:22076220-22076242 GCCAAGGCCGGCAGATCACAAGG + Intergenic
1145712607 17:26991152-26991174 ACCCAGCCCAGCCCACCAAAAGG - Intergenic
1146331168 17:31928611-31928633 GCCAAGGCCGGCGGATCACACGG + Intergenic
1149326014 17:55530548-55530570 GCCAAGGCAGGCGGATCAAAAGG + Intergenic
1154211472 18:12382646-12382668 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1157141234 18:45109028-45109050 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1158295390 18:55991390-55991412 GCCAAGGCCGGCGGATCACAAGG - Intergenic
1161118302 19:2511708-2511730 ACGGTGGCCGGCCCGTCAAAGGG + Exonic
1162140682 19:8583922-8583944 GCCAAGGCCGGCGGATCACAAGG + Intronic
1162166194 19:8754937-8754959 ACCAAGACTGGCCACTCAAATGG - Intergenic
1162167260 19:8762393-8762415 ACCAAGACTGGCCACTCAAATGG - Intergenic
1162168204 19:8768693-8768715 ACCAAGACTGGCCACTCAAATGG - Intergenic
1162169269 19:8776146-8776168 ACCAAGACTGGCCACTCAAATGG - Intergenic
1162169948 19:8781458-8781480 ACCAAGACTGGCCACTCAAATGG - Intergenic
1162521473 19:11182607-11182629 GCCAAGGCAGGCCAATCACAAGG + Intronic
1163346646 19:16747267-16747289 GCCAAGGCGGGCCGATCAAGAGG - Intronic
1163739619 19:19003423-19003445 GCCACGGCGTGCCCATCAAAAGG + Intronic
1163847267 19:19644776-19644798 GCCAAGGCGGGCCCATCACAAGG - Intergenic
1164005844 19:21148227-21148249 GCCAAGGCGGGCCGATCACAAGG - Intronic
1164711304 19:30359007-30359029 GGGAAAGCCGGCCCATCAAAAGG + Intronic
1165219289 19:34301915-34301937 ACCAAGGCGGGCAGATCACAAGG - Intronic
1165229086 19:34375380-34375402 ACCAAGGCAGGCAGATCACAAGG - Intronic
1165688692 19:37845171-37845193 ACCGAGGCAGGCGCATCACAAGG + Intergenic
1165999309 19:39868766-39868788 GCCAAGGCGGGCGGATCAAAAGG - Intronic
1166849124 19:45749768-45749790 ACCAAGGCGGGCAGATCACAAGG + Intronic
1167066714 19:47191819-47191841 GCCAAGGCGGGCCGATCACAAGG + Intronic
1168192135 19:54746691-54746713 ACCATGCCCAGCCCATCCAATGG - Intronic
1168194413 19:54763247-54763269 ACCATGCCCAGCCCATCCAATGG - Intronic
1168196464 19:54777969-54777991 ACCAAGCCCAGCCCATCCAATGG - Intronic
1168204825 19:54842225-54842247 ACCATGCCCAGCCCATCCAATGG - Intronic
925804014 2:7630729-7630751 GCCAAGGCAGGCCGATCACAAGG + Intergenic
926333555 2:11846406-11846428 GCCAAGGCGGGCCGATCACAAGG - Intergenic
926431894 2:12795644-12795666 GCCAAGGCAGGCGGATCAAAAGG + Intergenic
927738570 2:25545854-25545876 GCCAAGGCAGGCCCATCACTTGG - Intronic
928007660 2:27578159-27578181 ACCAAGGCCAACCCCTCAAATGG + Exonic
928317024 2:30254633-30254655 AGCAGGGCAGGCCCAGCAAAAGG - Intronic
928516575 2:32050091-32050113 GCCAAGGCAGGCACATCAAGAGG + Intergenic
930655642 2:54004642-54004664 GCCAAGGCGGGCCGATCACAAGG - Intronic
932823936 2:74923488-74923510 ACCGAGGCAGGCCGATCACAAGG - Intergenic
935226761 2:101059704-101059726 ACCAAGGCAGGCGGATCACAAGG + Intronic
935263509 2:101375349-101375371 ACCGAGGCCTGTCAATCAAAGGG + Intronic
938233307 2:129680364-129680386 ACCAAGGCAGGCAGATCACAAGG + Intergenic
938277240 2:130037633-130037655 ACCAAGGCGGGCCGATCACGGGG - Intergenic
938328206 2:130428438-130428460 ACCAAGGCGGGCCGATCACGGGG - Intergenic
938438145 2:131299739-131299761 ACCAAGGCGGGCCGATCACGGGG + Intronic
938595931 2:132787113-132787135 ACCAAGGCAGGTGGATCAAAAGG + Intronic
939735557 2:145840093-145840115 GCCAAGGCGGGCACATCACAAGG - Intergenic
941888946 2:170558065-170558087 ACCAAGGCGGGCGGATCACAAGG + Intronic
942350767 2:175050644-175050666 ACCACGCCCGGCCCATAATAAGG + Intergenic
942642577 2:178075240-178075262 AGCAATGACAGCCCATCAAAAGG + Intronic
942862100 2:180627183-180627205 ACCAAGGAATACCCATCAAATGG - Intergenic
943547082 2:189293849-189293871 GCCAAGGCGGGCACATCACAAGG + Intergenic
943573744 2:189606256-189606278 ACCAAGGAAGGCCCAGCAAAGGG - Intergenic
944697416 2:202214993-202215015 ACCAAGGCAGGCGGATCACAAGG + Intronic
945185199 2:207133235-207133257 ACCAAAGCAGGGCCATCTAATGG - Intronic
945280278 2:208029348-208029370 ACCAAGGCGGGCAGATCACAAGG - Intergenic
946242198 2:218363244-218363266 GCCAAGGCGGGCCGATCACAAGG + Intronic
946450421 2:219774631-219774653 ACCAGGGCCAGCCCAGAAAAGGG - Intergenic
947125874 2:226867949-226867971 GCCAAGGCCGGCAGATCACAAGG - Intronic
947721616 2:232372947-232372969 ATTAAGGCCTGCCCATCAGATGG - Intergenic
1168889090 20:1282340-1282362 ACCATGACAGACCCATCAAATGG + Intronic
1169429482 20:5523952-5523974 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1171509604 20:25670814-25670836 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1172333375 20:34092434-34092456 ACCAAGGCAGGCGGATCACAAGG + Intronic
1172763600 20:37338906-37338928 ACCAAGGCGGGCGGATCACAAGG - Intergenic
1173361891 20:42352128-42352150 ATCAAGGCCAGCACAGCAAAGGG - Exonic
1174605043 20:51755201-51755223 ACCAAGGCAGGCGGATCACAAGG + Intronic
1175364323 20:58441405-58441427 GCCAAGGCGGGCCGATCACAAGG + Intronic
1176639960 21:9293082-9293104 ACCAAGGCGGGCGGATCACAAGG + Intergenic
1177415867 21:20792856-20792878 GCCAAGGCGGGCCGATCATAAGG + Intergenic
1177451935 21:21279589-21279611 GCCAAGGCCGGCAGATCACAAGG - Intronic
1178378179 21:32085530-32085552 ACCAAGGTCAGCCCAGCAGATGG + Intergenic
1179681840 21:43027683-43027705 ACCAAGGCAGGCAGATCACAAGG + Intronic
1180668470 22:17534001-17534023 ACCATGCCCGGCCGAGCAAAGGG + Intronic
1181183617 22:21085248-21085270 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1181268956 22:21647637-21647659 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1182381881 22:29897307-29897329 GCCAAGGCAGGCCAATCACAAGG - Intronic
1182654290 22:31877515-31877537 GCCAAGGCCGGCAGATCACAAGG + Intronic
1183430881 22:37765046-37765068 GCCAAGGCCGGCAGATCACAAGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
950382779 3:12631362-12631384 ACCAAGGCAGGCGGATCAAGAGG + Intronic
951857915 3:27218370-27218392 ACCAAGGCGGGCGGATCACAAGG + Intronic
951891262 3:27570233-27570255 GCCAAGGCAGGCCTATCACAAGG + Intergenic
952369177 3:32703156-32703178 GCCAAGGCGGGCACATCACAAGG - Intronic
954590403 3:51777701-51777723 CCCAAGGCAGGCCCAGCAGACGG + Intergenic
955695256 3:61629386-61629408 ACCAAGGCAGGCGGATCACAAGG - Intronic
956241310 3:67133789-67133811 GCCAAGGCCGGCTGATCATAAGG - Intergenic
957184256 3:76922075-76922097 ACCAAGGCGGGCAGATCAAGAGG + Intronic
957514198 3:81230266-81230288 GCCAAGGTGGGCCCATCACATGG - Intergenic
959212102 3:103398375-103398397 GCCAAGGCCAGCGCATCACAAGG - Intergenic
959703871 3:109322498-109322520 GCCAAGGCCGGCAGATCACAAGG + Intergenic
961143930 3:124578612-124578634 ACCAAGCCCGGCCAATCTATGGG - Intronic
961595559 3:128013423-128013445 ACCAAGGCGGGCAGATCACAAGG + Intergenic
961757510 3:129138040-129138062 ACCAAGGCGGGCGGATCACAAGG + Intronic
962579975 3:136789431-136789453 GCCAAGGCGGGCACATCACAAGG + Intergenic
965750458 3:171970052-171970074 ACCAAGGCAGGCGGATCACAAGG + Intergenic
966509604 3:180747241-180747263 GCCAAGGCGGGCAGATCAAAAGG + Intronic
966749163 3:183305614-183305636 GCCAAGGCCGGCGGATCACAAGG + Intronic
967748610 3:193087723-193087745 ACCAAGGCGGGCAGATCACAAGG + Intergenic
968560117 4:1275547-1275569 ACCAAGGCAGGCGTATCACAAGG + Intergenic
969509734 4:7610891-7610913 ACCAAGACCTGCCCATCACGGGG - Intronic
969558830 4:7932785-7932807 GCCAAGGCCGGCAGATCATAAGG + Intronic
969626581 4:8308732-8308754 GCCAAGGCAGGCGCATCACAAGG - Intergenic
979035867 4:115716740-115716762 GCCAAAGCAGGCCCATCACAAGG + Intergenic
979248218 4:118534086-118534108 ACCAAGGCGGGCGGATCACAAGG + Intergenic
980044913 4:127976805-127976827 ACCAAGGCGGGCGGATCACAAGG + Intronic
982922598 4:161294166-161294188 GCCAAGGCAGGCCGATCACAAGG + Intergenic
984084618 4:175293478-175293500 ACCAAGGCAGGCGGATCACAAGG - Intergenic
984187886 4:176568449-176568471 ACCAAGGCAGCCCCATCAGCAGG - Intergenic
985863826 5:2495731-2495753 GCCAAGGCAGGCCCATCAGAAGG + Intergenic
988282144 5:29164014-29164036 GCCAAGGCCGGCAGATCACAAGG + Intergenic
988666659 5:33336148-33336170 ACCATGCCCGGCCCCTTAAATGG + Intergenic
989173912 5:38501517-38501539 GCCAAGGCAGGCACATCACAAGG + Intronic
990102013 5:52202422-52202444 GCCAAGGCGGGCGGATCAAAAGG - Intergenic
992644219 5:78797194-78797216 ACCAAGGCAGGCGGATCACAAGG - Intronic
993556589 5:89347271-89347293 ACCAAGGCAGGCGGATCACAGGG - Intergenic
993915414 5:93739098-93739120 ACCAAGGCAGGCAGATCACAAGG - Intronic
994252016 5:97547114-97547136 ACCCAGGTAGGCCAATCAAAGGG - Intergenic
994885772 5:105559366-105559388 ACCAAGGCGGGCGAATCACAAGG - Intergenic
995559336 5:113363997-113364019 ACCAAGGCAGGCAGATCACAAGG + Intronic
996731708 5:126723375-126723397 GCCAAGGCGGGCGCATCACAAGG + Intergenic
997171957 5:131731363-131731385 ACCAAGCCCTGCCCATAAAGGGG - Intronic
997173894 5:131754044-131754066 ACCAAGGCAGGCACATCACGAGG - Intronic
997433352 5:133856804-133856826 ACCAAGGAGGGCCATTCAAATGG + Intergenic
997548428 5:134731104-134731126 ACCGAGGCTGGCGCATCACAAGG + Intergenic
998089543 5:139356211-139356233 ACCAAGGCAGGCGGATCACAAGG + Intronic
998206541 5:140161178-140161200 ACCAAGGCAGGCGGATCACAAGG - Intergenic
998745031 5:145248558-145248580 GCCAAGGCAGGCAGATCAAAAGG + Intergenic
1003069041 6:2929890-2929912 ACCAAGGCAGGCAGATCACAAGG + Intergenic
1004007665 6:11652021-11652043 ACCAAGAGTGGCCCAACAAAGGG - Intergenic
1006190755 6:32207161-32207183 ACCAAGGCGGGCAGATCACAAGG - Intronic
1006393873 6:33774402-33774424 ACCAAGGCGGGCAGATCACAAGG - Intronic
1006564287 6:34941218-34941240 GCCAAGGCAGGCCGATCACAAGG - Intronic
1009574496 6:65434552-65434574 GCCAAGGCGGGCCGATCACAAGG - Intronic
1012216170 6:96587289-96587311 ACCAAGTCGGGACCATAAAATGG - Intronic
1013408389 6:109862572-109862594 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1015593785 6:134846976-134846998 CCCAAGGCTGCCCTATCAAAGGG - Intergenic
1015845597 6:137517235-137517257 GTCAAGTTCGGCCCATCAAAGGG - Intergenic
1017156510 6:151327047-151327069 ACCAAGGCGGGCAGATCACAAGG - Intronic
1018436321 6:163762425-163762447 ACCAAGGCAGGCCGATCACAAGG + Intergenic
1018497600 6:164366018-164366040 GCCAAGGCGGGCCGATCAAGAGG - Intergenic
1018796356 6:167188239-167188261 GCCAAGGCAGGCCGATCACAAGG + Intronic
1018819962 6:167366820-167366842 GCCAAGGCAGGCCGATCACAAGG - Intronic
1018998357 6:168727084-168727106 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1019402335 7:862915-862937 ACCAAGGCAGGCAGATCACAAGG + Intronic
1020056253 7:5119319-5119341 ACCAAGGCGGGCGGATCACAAGG - Intergenic
1020789482 7:12608709-12608731 GCCAAGGCCGGCGGATCACAAGG - Intronic
1023956477 7:44890696-44890718 GCCAAGGCCGGCGGATCACAAGG - Intergenic
1025795029 7:64731630-64731652 GCCAAGGCCGGCGGATCACAGGG + Intergenic
1026563753 7:71472452-71472474 ACCAAGGCAGGCTGATCAAATGG + Intronic
1027666196 7:81044987-81045009 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1027719431 7:81721009-81721031 GCCAAGGCGGGCCCATCACGAGG + Intronic
1029995673 7:105005800-105005822 ACCAAGGCGGGCAGATCACAAGG - Intergenic
1030463218 7:109867002-109867024 GCCAAGGCGGGCAGATCAAAAGG - Intergenic
1031276645 7:119732593-119732615 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1031737894 7:125389692-125389714 ACCATGGCTGGCCAATAAAAGGG + Intergenic
1031839308 7:126717996-126718018 GCCAAGGCCGGCGGATCACAAGG + Intronic
1032258289 7:130314304-130314326 CCCAAGGCCCTCCCATTAAAGGG - Intronic
1032355219 7:131204729-131204751 GCCAAGGCAGGCCGATCACAAGG + Intronic
1032426791 7:131829283-131829305 ACCAAGGCGGGCAGATCACAAGG - Intergenic
1035892060 8:3356440-3356462 GCCAAGGCGGGCACATCACATGG + Intronic
1035976142 8:4313779-4313801 GCCAAGGCAGGCGGATCAAAAGG + Intronic
1036162679 8:6404474-6404496 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1037135044 8:15450449-15450471 ACCAAGGCAGGCAGATCACAAGG + Intronic
1038587965 8:28808416-28808438 ACCAAGGCAGGCAGATCACAAGG - Intronic
1038616228 8:29097935-29097957 GCCAAGGCCGGCAGATCACAAGG + Intronic
1038943005 8:32326240-32326262 ACCAAGGTCGGCAGATCACAAGG - Intronic
1039939929 8:42081419-42081441 GCCAAGGCCGGCGGATCACAAGG - Intergenic
1040438387 8:47416009-47416031 ACCAAGGCCGGCAGATCACAAGG + Intronic
1043102382 8:76061686-76061708 AGCAAGACAGGCCCATCACATGG - Intergenic
1050233696 9:3555982-3556004 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1051290565 9:15541339-15541361 ACCAAGGCAGGCAGATCACAAGG + Intergenic
1052096782 9:24392791-24392813 ACCAAGGCGGGCAGATCACAAGG + Intergenic
1053012992 9:34645919-34645941 ACCAAGGCAGGCGGATCACAAGG - Intronic
1053248524 9:36555181-36555203 ACCAAGGCGGGCAGATCACAAGG - Intergenic
1057129009 9:92640415-92640437 ACCAAGGCCCACCCAGCAACTGG + Intronic
1057281372 9:93714082-93714104 GCCAAGGCCGGCGGATCACAAGG + Intergenic
1057618625 9:96616489-96616511 ACCAAGGCGGGCGGATCACAAGG + Intronic
1058059687 9:100482007-100482029 GCCAAGGCAGGCACATCACAAGG - Intronic
1060530220 9:124343477-124343499 CCCATAGCCGGCCCATCCAAGGG + Intronic
1060979431 9:127784233-127784255 ACCAAGGCAGGCGGATCACAAGG - Intergenic
1061047077 9:128171491-128171513 GCCAAGGCAGGCACATCATAAGG + Intronic
1061344265 9:130009566-130009588 ACCAAGGCGGGCGGATCACAAGG + Intronic
1061941231 9:133885217-133885239 ACCAAGGGCGGCCCAGGGAAGGG + Intronic
1185651365 X:1650307-1650329 ACCACACCCGGCCCATAAAAGGG + Intergenic
1186684098 X:11906379-11906401 ACCAAGGCAGGCAGATCACAAGG - Intergenic
1186734061 X:12442067-12442089 ACCAAGACTGCCCCAGCAAACGG - Intronic
1187501007 X:19838652-19838674 GCCAAGGCCGGCGGATCACAAGG + Intronic
1189469119 X:41300448-41300470 ACCATGCCCGGCCCATTGAATGG - Intergenic
1192747105 X:73950114-73950136 GCCAAGGCGGGCGGATCAAAAGG - Intergenic
1195219674 X:102734382-102734404 GCCAAGGCAGGCGGATCAAAAGG + Intronic
1195896541 X:109751107-109751129 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1196068216 X:111489340-111489362 ACCAAGGCGGGCAGATCAAGAGG + Intergenic
1196701335 X:118672667-118672689 GCCAAGGCGGGCGCATCACAAGG - Intronic
1197916299 X:131539694-131539716 ACCAAGGGCTGCAGATCAAAGGG + Intergenic
1197937007 X:131750000-131750022 ACCACGTCCGGCCCATAATATGG - Intergenic
1200804602 Y:7420158-7420180 GCCAAGGCAGGCAGATCAAAAGG - Intergenic
1201341594 Y:12939909-12939931 ACCAAGGCAGGCAGATCACAAGG - Intergenic
1202051834 Y:20789443-20789465 GCCAAGGCAGGCACATCACACGG - Intergenic