ID: 1104081626

View in Genome Browser
Species Human (GRCh38)
Location 12:125434847-125434869
Sequence GCACACTGGTCTGATGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104081621_1104081626 1 Left 1104081621 12:125434823-125434845 CCCCTGAAGTGGTGTGTTTCTTG 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081619_1104081626 15 Left 1104081619 12:125434809-125434831 CCTTTTATTGTAAACCCCTGAAG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081623_1104081626 -1 Left 1104081623 12:125434825-125434847 CCTGAAGTGGTGTGTTTCTTGCG 0: 1
1: 0
2: 1
3: 3
4: 95
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081622_1104081626 0 Left 1104081622 12:125434824-125434846 CCCTGAAGTGGTGTGTTTCTTGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081617_1104081626 28 Left 1104081617 12:125434796-125434818 CCTGCACCGAATTCCTTTTATTG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081618_1104081626 22 Left 1104081618 12:125434802-125434824 CCGAATTCCTTTTATTGTAAACC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120
1104081616_1104081626 29 Left 1104081616 12:125434795-125434817 CCCTGCACCGAATTCCTTTTATT 0: 1
1: 0
2: 1
3: 10
4: 181
Right 1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104081626 Original CRISPR GCACACTGGTCTGATGCAGC GGG Intronic
900129743 1:1082354-1082376 GCACCCTGGTCTCAGGCAGCTGG + Exonic
900950201 1:5854348-5854370 GCACACTGGCCGGATGCTGCTGG - Intergenic
901957287 1:12795759-12795781 GCCCACTGGTGTGGCGCAGCAGG - Exonic
901965306 1:12861542-12861564 GCCCACTGGTGTGGCGCAGCAGG - Exonic
901973686 1:12928016-12928038 GCCCACTGGTGTGGCGCAGCAGG - Intronic
901980699 1:13031893-13031915 GCCCACTGGTGTGGCGCAGCAGG - Exonic
902001390 1:13197038-13197060 GCCCACTGGTGTGGCGCAGCAGG + Exonic
902011492 1:13273751-13273773 GCCCACTGGTGTGGCGCAGCAGG + Intergenic
903451595 1:23457199-23457221 GAACACTGTTCTGTTGCACCCGG - Intronic
906692460 1:47801574-47801596 GCACACTCTCCTGCTGCAGCAGG + Exonic
907650594 1:56291305-56291327 GCACACTGGGCTGTGGCAGAAGG + Intergenic
910514138 1:88038537-88038559 GCAAACTGACCTGATGTAGCTGG + Intergenic
914226227 1:145721376-145721398 GCACCCTGTTGTGATGCAGGCGG - Intronic
919740650 1:200979492-200979514 TCACAGTGGTCGGCTGCAGCAGG - Intronic
923142906 1:231176245-231176267 GTACAATGGTCTCCTGCAGCAGG - Intronic
1064946987 10:20801550-20801572 GCACAATGGTTTTATGCAACTGG + Intronic
1066162631 10:32750539-32750561 GCCCACTGCTGTGATGCTGCAGG + Intronic
1067141938 10:43665754-43665776 GCACACAGTTTTGATGAAGCTGG - Intergenic
1072432392 10:95384654-95384676 GTACACTGAGCTGGTGCAGCCGG - Intronic
1076321352 10:129584277-129584299 GCCTGCTGGCCTGATGCAGCAGG + Intronic
1076634148 10:131871952-131871974 CCCCACTGGTCTGAGACAGCAGG - Intergenic
1077378389 11:2216126-2216148 GCAGACTGGATGGATGCAGCTGG + Intergenic
1079436608 11:20459948-20459970 GGACCGTGGTCTGGTGCAGCTGG + Intronic
1081284070 11:41246251-41246273 CCAGAGTGGGCTGATGCAGCAGG + Intronic
1083641159 11:64146146-64146168 ACACACAGGTCTGGTGCACCAGG + Intronic
1084938964 11:72602207-72602229 ACACACTGGGGGGATGCAGCTGG + Intronic
1085509655 11:77081837-77081859 GCACTCAGGTCTGCTGCAGCAGG - Intronic
1085859460 11:80214851-80214873 TCACAAGGGTCTGCTGCAGCTGG + Intergenic
1092915720 12:13187295-13187317 CCACCCTAGTCTGAAGCAGCAGG + Intergenic
1100358585 12:93855255-93855277 ACACACAGGCCTGAGGCAGCAGG + Intronic
1103702251 12:122853931-122853953 GCACACTGGTGTGTGGGAGCTGG + Intronic
1103903766 12:124316926-124316948 CCACACTGGTAGGATGCAGCTGG + Intergenic
1104081626 12:125434847-125434869 GCACACTGGTCTGATGCAGCGGG + Intronic
1106583575 13:31037944-31037966 GCACACAGGTGGGACGCAGCTGG + Intergenic
1106586240 13:31058663-31058685 ACTCTCTGGTCTGAGGCAGCAGG - Intergenic
1106776504 13:33015497-33015519 GCGCACAGGTCTGCTGGAGCGGG - Intergenic
1111243844 13:85509037-85509059 GCACATTTGGCTGCTGCAGCGGG - Intergenic
1112317464 13:98375971-98375993 GGACACTGTTCTCAGGCAGCAGG + Intronic
1112424935 13:99289736-99289758 GCACACTTGTCTAATGCAGTTGG + Intronic
1113185375 13:107681370-107681392 GGTCACTGGTCTGGTGGAGCTGG + Intronic
1113647238 13:112007272-112007294 GCACACAGGTCTCACGCGGCTGG + Intergenic
1114143523 14:19946007-19946029 ACACACTGGATTGATGCAGTAGG - Intergenic
1116145856 14:41068347-41068369 ACACAATGGTCACATGCAGCTGG + Intergenic
1117638822 14:57775271-57775293 GCACACTTATCGGCTGCAGCAGG - Intronic
1118880270 14:69819778-69819800 CAACACTGGTCTGCTGCATCCGG - Intergenic
1119610596 14:76058584-76058606 GCCCACTAGTCTCATGCACCAGG - Intronic
1119788762 14:77331000-77331022 GGAGACTGCCCTGATGCAGCAGG - Intronic
1120717272 14:87853346-87853368 GCCCAGTGGTATGATGAAGCAGG + Intronic
1122205182 14:100144797-100144819 GCACACTGCTCTGTGGCTGCAGG - Exonic
1124007362 15:25805243-25805265 CCACGCTGGTCTGTGGCAGCCGG + Intronic
1126420419 15:48466542-48466564 CCTCACTGGGATGATGCAGCAGG - Intronic
1131530550 15:93187694-93187716 GCTCCCTGGCCTGAAGCAGCAGG + Intergenic
1132709867 16:1261668-1261690 GCACACTCGCCTGCTGCAGGCGG + Intergenic
1132774831 16:1587588-1587610 GCACACTGAGCTAACGCAGCAGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135770861 16:25217368-25217390 GGACACTGGGCTGCTGCAGCCGG + Exonic
1135970849 16:27070905-27070927 GGACACTGGGCTGAGGCAGGGGG - Intergenic
1137837599 16:51608008-51608030 CCACACTGGTCTGCAGCTGCAGG - Intergenic
1139473137 16:67188889-67188911 GCAGACTGGTGTGTGGCAGCTGG - Exonic
1142975642 17:3642352-3642374 GCAAAGTGATCTCATGCAGCAGG - Intronic
1145249519 17:21289611-21289633 GCACACAGGCCTGATGGAGGTGG - Intronic
1147363324 17:39944721-39944743 GCACAGTGGTCTGATGACCCAGG + Exonic
1147521522 17:41177895-41177917 GCACTGGGGTCTGAAGCAGCTGG + Exonic
1148347065 17:46910354-46910376 CCACACTGGCCTGACACAGCTGG + Intergenic
1149284782 17:55150396-55150418 GGACACTGGTCTGATGGAACTGG - Intronic
1160898106 19:1412271-1412293 GCTCACTGGCCTGAGGCAGTGGG + Intronic
1160982804 19:1823924-1823946 GCACACTGGGGGGAAGCAGCAGG + Intronic
1166147913 19:40849971-40849993 GCTCACTGATCTGATGGAGGTGG + Exonic
925444536 2:3916240-3916262 GCCCAGTCTTCTGATGCAGCTGG + Intergenic
926230902 2:11003131-11003153 CCACAATGGTCTGATGCAATGGG - Intergenic
926939255 2:18117771-18117793 GTACACTGCTCAGCTGCAGCAGG + Intronic
930367679 2:50461552-50461574 GCACACTGGTGTGATGATGGTGG + Intronic
935200098 2:100848966-100848988 GCACACGGGGCAGATGCCGCAGG + Intronic
936077758 2:109412514-109412536 GCACTCTGCTCTGCAGCAGCGGG - Intronic
936149661 2:110008344-110008366 GCACTCTGGACAGAGGCAGCAGG - Intergenic
936195017 2:110363025-110363047 GCACTCTGGACAGAGGCAGCAGG + Intergenic
945253247 2:207782377-207782399 GCACTTTGGCCTGCTGCAGCAGG - Intergenic
946172138 2:217901944-217901966 GCTCATTGGTCCGAGGCAGCTGG - Intronic
946728782 2:222688758-222688780 GCGCTATGGGCTGATGCAGCAGG - Intronic
1169386824 20:5156947-5156969 GCACAGTGCTCTGATGAATCAGG + Intronic
1170439663 20:16366195-16366217 CCACCCTGGGCAGATGCAGCAGG + Intronic
1171125111 20:22595887-22595909 CCAGGCTGGTCTGAAGCAGCTGG - Intergenic
1174115183 20:48222007-48222029 CCACCATGTTCTGATGCAGCAGG - Intergenic
1178317200 21:31576586-31576608 GCCCACTTGTATGATGCTGCTGG - Intergenic
1179951851 21:44712670-44712692 GCAAACTGGTCTGAGGCCGATGG + Intergenic
1180583093 22:16860021-16860043 GCACTCTGGACAGAGGCAGCAGG + Intergenic
1181545341 22:23599262-23599284 GCACACTGGGCTGGGCCAGCAGG - Intergenic
949683428 3:6541441-6541463 GCCAAGTGGTCTGATTCAGCAGG - Intergenic
953417117 3:42729026-42729048 ACTCACTGGTCTCATGCAGCTGG - Intronic
954509212 3:51106846-51106868 GCACACTTGTCTGCTGGGGCAGG - Intronic
962948876 3:140199664-140199686 CCACACTTGACTGATACAGCTGG + Intronic
965181926 3:165415044-165415066 GCACACTTGTCAGCTGCAGCGGG - Intergenic
971884914 4:32432124-32432146 GTACACTTGTCAGCTGCAGCAGG - Intergenic
984556882 4:181225134-181225156 ACACACTGGTGAGCTGCAGCTGG - Intergenic
986215738 5:5717213-5717235 GCACACAGGTTACATGCAGCAGG - Intergenic
988192920 5:27963280-27963302 GCACACTCGTCAGCTGCATCTGG + Intergenic
995065872 5:107861922-107861944 GCTCACTGATGTGCTGCAGCTGG + Intronic
995462403 5:112418585-112418607 CCACACTGGTGGGACGCAGCTGG + Intronic
1000261180 5:159590128-159590150 GCACACTGGTCATATCCAGCAGG - Intergenic
1000383163 5:160647244-160647266 ACCCACTGGTCTGATGCCTCTGG - Intronic
1005019343 6:21402542-21402564 GCAGACTGGGCTGATGCATGAGG + Intergenic
1007400847 6:41601416-41601438 GCACAGGGGTCTGAGGCGGCGGG - Exonic
1011534811 6:88365262-88365284 GCACAGTGGTCTGAAGAACCTGG + Intergenic
1012308415 6:97689205-97689227 GCACACTGGGCTGGAGCATCAGG + Intergenic
1017147062 6:151244050-151244072 GAACAATGGTCTGTTGCAACAGG + Intronic
1018860076 6:167704785-167704807 GTACAGTGGTCTGAAGCAGCAGG - Intergenic
1018873512 6:167800770-167800792 GCACACTTGTAGGATGCAACTGG - Intergenic
1021232851 7:18106698-18106720 GCACACTGGGAGGCTGCAGCAGG - Intronic
1022836960 7:34127320-34127342 ACACAGTGGTGTGATGGAGCTGG + Intronic
1023907323 7:44531856-44531878 GCAGGGTGGTCTCATGCAGCAGG - Intronic
1028860581 7:95645919-95645941 GCCCCTTGGTCTGAAGCAGCCGG - Intergenic
1033884569 7:145929237-145929259 CTACACTGGTCTAGTGCAGCAGG - Intergenic
1034952862 7:155312826-155312848 GCACACACGTGTGATGAAGCAGG - Intergenic
1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG + Intronic
1044539221 8:93391220-93391242 ACACCCTGCTCTGATGAAGCCGG - Intergenic
1046983934 8:120366841-120366863 GGCCACTGGACTTATGCAGCTGG - Intronic
1047314373 8:123718848-123718870 GCAATCTGCTCTGTTGCAGCAGG - Intronic
1048243114 8:132764201-132764223 GCATACTGATTTGATGTAGCTGG - Intergenic
1049817951 8:144616692-144616714 GCACAGTGGCCTCAGGCAGCAGG + Intergenic
1050166818 9:2773267-2773289 ACACAGTGGTGTGCTGCAGCTGG + Intronic
1051166018 9:14262810-14262832 TGAAACTGGTCTGGTGCAGCAGG - Intronic
1051603646 9:18898320-18898342 GCACAATGACCTGATGGAGCTGG + Intronic
1051841096 9:21399135-21399157 GGCCACTGGTGGGATGCAGCTGG + Intergenic
1061959629 9:133981452-133981474 GCACTCTGCTCTGATGCTGAGGG + Intronic
1187644234 X:21328930-21328952 GCATACTCGTCAGCTGCAGCAGG - Intergenic
1188493134 X:30756594-30756616 GCACACTTGTTAGCTGCAGCAGG - Intergenic
1189823916 X:44898171-44898193 TCACACTGCACTGATGCTGCAGG + Intronic
1193467720 X:81868519-81868541 CCAGACTGGGCTGAGGCAGCAGG + Intergenic
1193590597 X:83384453-83384475 TCACACAGCTCTCATGCAGCTGG - Intergenic
1201376802 Y:13331227-13331249 TCACACAGGACTGATCCAGCTGG + Intronic
1201788313 Y:17809111-17809133 GCAAACTGGGCTGAAGCCGCAGG - Intergenic
1201813240 Y:18096877-18096899 GCAAACTGGGCTGAAGCCGCAGG + Intergenic