ID: 1104081772

View in Genome Browser
Species Human (GRCh38)
Location 12:125435722-125435744
Sequence AATCAGGGATTTCCCTACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104081772_1104081780 -5 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081780 12:125435740-125435762 TGATTTGGGGGCAGGAAGTCAGG 0: 1
1: 0
2: 0
3: 39
4: 327
1104081772_1104081782 16 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081782 12:125435761-125435783 GGGATGAGCTCACTGTGAAGAGG 0: 1
1: 0
2: 3
3: 23
4: 221
1104081772_1104081781 -4 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081781 12:125435741-125435763 GATTTGGGGGCAGGAAGTCAGGG 0: 1
1: 0
2: 2
3: 36
4: 470
1104081772_1104081783 22 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081783 12:125435767-125435789 AGCTCACTGTGAAGAGGTGCTGG 0: 1
1: 0
2: 0
3: 20
4: 158
1104081772_1104081784 27 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081784 12:125435772-125435794 ACTGTGAAGAGGTGCTGGACTGG 0: 1
1: 0
2: 3
3: 9
4: 169
1104081772_1104081785 30 Left 1104081772 12:125435722-125435744 CCGGTGTAGGGAAATCCCTGATT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1104081785 12:125435775-125435797 GTGAAGAGGTGCTGGACTGGAGG 0: 1
1: 0
2: 4
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104081772 Original CRISPR AATCAGGGATTTCCCTACAC CGG (reversed) Intronic
903509767 1:23866526-23866548 AATCCTGGAGTTCCCTACTCTGG - Intronic
907047028 1:51305657-51305679 AATCAGGGCTTTCTCTGCCCTGG - Intronic
908208135 1:61872042-61872064 AATCTGGGATTTCAATACATTGG - Intronic
908452901 1:64273640-64273662 AATCAGGGAGTTCCCTTTCCTGG + Intergenic
911427932 1:97744756-97744778 AATTATGTATTTTCCTACACTGG - Intronic
912178949 1:107194278-107194300 AACCAGAGACTTCCCTGCACTGG - Intronic
916618778 1:166473068-166473090 ATCCAGGCATTTCCATACACTGG + Intergenic
917263045 1:173190310-173190332 AAACAGGAATTCCCCTACCCAGG - Intronic
917266755 1:173228714-173228736 ATTTAAGGATTTCTCTACACTGG - Intergenic
924896730 1:248346176-248346198 AATCATGGATTTCCATATACTGG + Intergenic
1075937845 10:126359062-126359084 AAACAGGAGTTTCCCTGCACAGG - Intronic
1075990730 10:126836556-126836578 AATCTGTGTTTTCCCAACACGGG - Intergenic
1077754545 11:5012249-5012271 AAACAGGGATTTCAATACATAGG - Intergenic
1077999853 11:7485022-7485044 ACTCAAGGATTTCCTTACAAAGG + Intergenic
1078757577 11:14225425-14225447 AATCAAGCATTTCCTTACTCAGG - Intronic
1079752690 11:24218379-24218401 ATTTAAGGATTTCTCTACACTGG - Intergenic
1079977104 11:27105377-27105399 ATTTAAGGATTTCCCTACAGTGG - Intronic
1086146762 11:83560725-83560747 GATCAGGGATTTTCTTCCACAGG + Intronic
1087601044 11:100316059-100316081 ATTCAGAGATTACCATACACAGG - Intronic
1087831289 11:102822100-102822122 AAAAAGGGGTTTCCCTGCACAGG + Intergenic
1090810090 11:130231493-130231515 AATGAGGGATTACCCATCACTGG - Exonic
1095888476 12:47213059-47213081 AATCAGTGATTTCACTATTCAGG - Intronic
1096880275 12:54662005-54662027 CAAAAAGGATTTCCCTACACAGG - Intergenic
1096958380 12:55550675-55550697 AAGTAGGAATTTCCCTACACAGG - Intergenic
1104081772 12:125435722-125435744 AATCAGGGATTTCCCTACACCGG - Intronic
1107360611 13:39613801-39613823 AATCATTTATTTCCCTACCCAGG + Intergenic
1107687524 13:42918700-42918722 AACCAGGGATTTCTGAACACAGG - Intronic
1108230794 13:48338536-48338558 ATTTAAGGATTTCTCTACACTGG + Intronic
1114347490 14:21811734-21811756 AATCAGGGAATCCCCTTCAGAGG - Intergenic
1118533127 14:66729059-66729081 AAACAGGAGTTTCCCTGCACAGG + Intronic
1120146136 14:80981188-80981210 CATCAGGGATTTCACTGCTCAGG + Intronic
1124270125 15:28272833-28272855 CAACAGGTATTTCCATACACAGG + Intronic
1128522488 15:68385015-68385037 AATGAGTGAGTTCCCTACACTGG - Intronic
1137503531 16:49029967-49029989 ATTTAAGGATTTCTCTACACTGG - Intergenic
1147036436 17:37685037-37685059 AAACAGGGACCTCCCTCCACTGG - Intergenic
1158512752 18:58106151-58106173 CAGCACGGATGTCCCTACACAGG - Intronic
1161624874 19:5320388-5320410 TATCAGGCTTGTCCCTACACTGG - Intronic
925097672 2:1220259-1220281 GATCAGGGCTTGCCCTGCACTGG + Intronic
928835071 2:35533839-35533861 AATGTGGTATTTCCATACACTGG + Intergenic
935450353 2:103201821-103201843 ATTTAAGGATTTCTCTACACTGG - Intergenic
936167825 2:110139300-110139322 ATTCAGGGCTTTCCCTCCTCAGG + Intronic
946547064 2:220755825-220755847 TATGAAGGCTTTCCCTACACGGG - Intergenic
946998993 2:225431462-225431484 AATCATTAATTACCCTACACAGG - Intronic
948961243 2:241339753-241339775 AGTGAGGGAGTTCCCCACACAGG - Intronic
949063038 2:241972446-241972468 AAACAGGAATTTCCCTGCACAGG + Intergenic
1168942107 20:1721460-1721482 ATTCAGGGATTGACTTACACAGG - Intergenic
1171460443 20:25295175-25295197 TAACTGGGATTTGCCTACACAGG - Intronic
1173392883 20:42650510-42650532 AATCAGGGATTGGACTAAACTGG + Intronic
1175588564 20:60168152-60168174 AATGAGTTATTTCCCTCCACTGG - Intergenic
1178464964 21:32839678-32839700 ACTCAGGGGTTTCCCTGAACAGG + Intergenic
1179152885 21:38823589-38823611 AAGCAGGGATTACCCCCCACAGG - Exonic
1179971607 21:44838898-44838920 AATCACGGAGTTCCTTACAGAGG - Intergenic
1181681855 22:24500880-24500902 TTTCAGGGATTTTCCTGCACAGG + Intronic
1182145801 22:27996053-27996075 AGGCAAGGGTTTCCCTACACGGG - Intronic
949913323 3:8934443-8934465 AAACAGGTATTTCACTACAGAGG + Intronic
950383146 3:12634562-12634584 ACCCAGGGATTTCCCTCCATTGG - Intronic
950925893 3:16741627-16741649 AATGAGGTTTTTCCCTACCCAGG - Intergenic
951211064 3:19975306-19975328 AATCTGTGATTTCACTACAAAGG + Intronic
952796345 3:37242782-37242804 TATCAGGGACTTCCCGACGCTGG + Intergenic
956493576 3:69800311-69800333 AATGTGGTATATCCCTACACTGG - Intronic
961648893 3:128407722-128407744 AATCAGGGAGTACCCCACCCAGG + Intronic
965203449 3:165691617-165691639 AAACAGGAGTTTCCCTGCACAGG - Intergenic
967687859 3:192438551-192438573 AATTAGTGATTTCACTGCACTGG - Intronic
972553541 4:40158255-40158277 AATGAAGGATTTCCTCACACTGG - Intergenic
972944614 4:44238788-44238810 ACTAAGGGATTTCTTTACACAGG + Intronic
975558434 4:75687300-75687322 AAACAGGAGTTTCCCTGCACAGG + Intronic
980079318 4:128327137-128327159 AATCAGTGATGGCCCCACACTGG - Intergenic
982644296 4:158004081-158004103 AATTATGGATTTGCCTAGACAGG - Intergenic
985210118 4:187583903-187583925 AATCAGGTATGTCCCAACTCTGG - Intergenic
990235339 5:53761384-53761406 AATCAGTGATTTGCCTTCAGTGG + Intergenic
997707306 5:135968600-135968622 AAACAGGAGTTTCCCTGCACAGG + Intergenic
999764913 5:154732622-154732644 AATCTGGGAATTCCAAACACAGG - Intronic
1002705109 5:181155508-181155530 AAACAGGGATGTGTCTACACAGG - Exonic
1010401964 6:75456128-75456150 AATCAGAGATTTTCCTCCCCAGG + Intronic
1012962426 6:105636199-105636221 AGTCAGGGATTTCCTCACAATGG + Intergenic
1013401594 6:109802023-109802045 AATCAGCTAATTCCCTCCACAGG + Intronic
1014567376 6:122966443-122966465 AATTATGTATTTCCCTTCACAGG + Intergenic
1016122620 6:140363107-140363129 AAACAGGAGTTTCTCTACACAGG + Intergenic
1016275386 6:142346028-142346050 CAGTAGGGATTTCCCTTCACAGG - Intronic
1020533539 7:9364659-9364681 AATCATGGATTTTCCTACTCTGG + Intergenic
1021718733 7:23485812-23485834 AATAAGGGATTCCTCTACAGGGG + Intergenic
1023193003 7:37603141-37603163 CTTCAGGGATTTCCCTCCCCAGG - Intergenic
1024830670 7:53451633-53451655 AATCTGGGATTTCCAGCCACAGG - Intergenic
1029254119 7:99257479-99257501 AAGCAGGGAACTCCCTGCACTGG - Intergenic
1030342081 7:108392429-108392451 ATTTAAGGATTTCTCTACACTGG + Intronic
1030833419 7:114254650-114254672 ATTTAAGGACTTCCCTACACTGG + Intronic
1036981359 8:13473377-13473399 AAACGGGGGTTTCCCTGCACAGG + Intronic
1040043966 8:42942479-42942501 AATCATGGTTTTCCCTGGACAGG - Intronic
1040390052 8:46941981-46942003 ATTTAAGGACTTCCCTACACTGG - Intergenic
1040658782 8:49544580-49544602 AAACAGGGCTTCCCCTGCACAGG - Exonic
1042232343 8:66570732-66570754 AATCAGGTAATTCCATACAATGG + Intronic
1042385009 8:68164268-68164290 AATGAAGGATTTCCATCCACAGG + Intronic
1044496034 8:92884283-92884305 AATCTGGGATTTCTCTACAGAGG + Exonic
1045788823 8:105956934-105956956 ATTTAAGGACTTCCCTACACTGG - Intergenic
1055441635 9:76342470-76342492 AATCAGGTATTCCCCCACACTGG + Intronic
1056105946 9:83346325-83346347 AATGTGGCATTTCCATACACTGG + Intronic
1058570081 9:106332171-106332193 AACCAGGGATATCCTTGCACAGG - Intergenic
1058759743 9:108119440-108119462 AACCAGGGAATACCCAACACTGG - Intergenic
1060376280 9:123117492-123117514 AAGCAGGGCTTACCATACACGGG + Intronic
1060427407 9:123518114-123518136 CATTAGGGATTCACCTACACGGG + Intronic
1060489864 9:124075081-124075103 AATCAGGGTTTGCCATCCACTGG + Intergenic
1061586117 9:131569891-131569913 AATGAGGTATTTCCATACAGTGG - Intergenic
1185730253 X:2455859-2455881 AATCAGGGATTTCCAGAGGCAGG + Intronic
1185731741 X:2467169-2467191 AATCAGGGATTTCCAAAGGCAGG + Intronic
1185732514 X:2472869-2472891 AATCAGGGATTTCCAAAGGCAGG + Intronic
1191138232 X:57089857-57089879 ATTTAAGGACTTCCCTACACTGG + Intergenic
1196390346 X:115201124-115201146 AAACGGGAATTTCCCTACACAGG - Intronic