ID: 1104083781

View in Genome Browser
Species Human (GRCh38)
Location 12:125456699-125456721
Sequence ACAGAGAGACTGCAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104083781_1104083789 27 Left 1104083781 12:125456699-125456721 CCTCCCCACTGCAGTCTCTCTGT 0: 1
1: 0
2: 4
3: 47
4: 439
Right 1104083789 12:125456749-125456771 GTTTGTCTCTGTGTCCTCAGAGG 0: 1
1: 0
2: 1
3: 46
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104083781 Original CRISPR ACAGAGAGACTGCAGTGGGG AGG (reversed) Intronic
900085275 1:890743-890765 ATGGAGAGACTGCAGGGGGCAGG + Intergenic
900140444 1:1137385-1137407 ACAGAGAGCCTGCGGGGGGCGGG - Intergenic
900330333 1:2131057-2131079 CCAGCTGGACTGCAGTGGGGTGG + Intronic
900513997 1:3072793-3072815 ACACAGAGGCTGCGGTGGAGGGG + Intronic
901657146 1:10775920-10775942 ACGGAGAGGCTGCAGCGGGAGGG - Intronic
901821749 1:11834789-11834811 ACTGTGGGACTGCAGTGGGCAGG + Intronic
902151905 1:14450122-14450144 AGAGAGAGACTGCAGGCGGGGGG - Intergenic
902209156 1:14892406-14892428 AAAGAGAGACAGCAGGGGGGAGG - Intronic
902725975 1:18336277-18336299 AAAGAGTGACTGCAGGTGGGTGG + Intronic
903140624 1:21336825-21336847 AGAGCGAGACTCCAGTGTGGGGG + Intronic
903180011 1:21600487-21600509 ACAAAGAGGCTGGAGTGGGGTGG - Intronic
903608368 1:24591672-24591694 ACAGAGTGGCAGGAGTGGGGAGG + Intronic
903788768 1:25878433-25878455 ACAAAAAGACTGGGGTGGGGTGG - Intergenic
903814083 1:26051821-26051843 GCAGAGAGACTGGAGAGGGTGGG - Exonic
904999097 1:34654150-34654172 ACAGAGGGACAGCAGAGGAGCGG + Intergenic
905339986 1:37271822-37271844 ACAGAGGGGCTGCAGTGGATAGG - Intergenic
906327320 1:44855203-44855225 ACAGAGAGAAGGAAGTGGTGGGG + Intronic
906615378 1:47229847-47229869 AGAGAGAGAATGAGGTGGGGGGG - Intronic
907303693 1:53502700-53502722 ACAGAGAGAGGAGAGTGGGGAGG + Intergenic
907303808 1:53503056-53503078 AGAGAGAGAGAGGAGTGGGGAGG + Intergenic
908133826 1:61106395-61106417 ACAGGGAGGGTGCAGTGAGGAGG - Intronic
908416863 1:63921662-63921684 GCAGAGAGAGTGGGGTGGGGCGG + Intronic
909737082 1:78975042-78975064 ACAAACAGACTGTAGTGGGCAGG + Intronic
911571631 1:99524381-99524403 ACATAGGAACTGCAGTGAGGTGG - Intergenic
911988115 1:104657483-104657505 CCAGAGACATTGCACTGGGGAGG - Intergenic
912603447 1:110963579-110963601 ACAGAGGGGCAGCCGTGGGGAGG + Intronic
913698768 1:121354362-121354384 ACAGAAAGAAAGAAGTGGGGGGG - Intronic
914138777 1:144925671-144925693 ACAGAAAGAAAGAAGTGGGGGGG + Intronic
914463506 1:147906588-147906610 ACAGAGAGAATGCTTTGGGAAGG - Intergenic
915262060 1:154684134-154684156 ACAGGGTAACTGAAGTGGGGGGG + Intergenic
915546239 1:156599937-156599959 ACTGAAATACTGCAGTGGTGTGG - Intronic
916240593 1:162634982-162635004 AGAGCCAGCCTGCAGTGGGGAGG + Intronic
916251440 1:162742456-162742478 ACAGAGAGAGTGGGGTGGCGGGG + Intronic
916275601 1:162990110-162990132 ACAGCAAGACTGGAGTGGGGAGG - Intergenic
917146705 1:171900033-171900055 AAAGAGAGACTGCACAGTGGGGG + Intronic
918078782 1:181190210-181190232 ACAGAGAGACAGAGGTGGGTGGG + Intergenic
919513659 1:198495113-198495135 TCACACCGACTGCAGTGGGGAGG - Intergenic
920062619 1:203238123-203238145 ACAGAGAGAAGGAGGTGGGGAGG - Intronic
920313798 1:205064081-205064103 ACAGGAAGACTGATGTGGGGTGG + Intronic
920486176 1:206373065-206373087 ACAGAAAGAAAGAAGTGGGGGGG - Intronic
920667197 1:207971745-207971767 TCTGAGACACTGAAGTGGGGAGG - Intergenic
920841806 1:209561648-209561670 AAAGAAAGACTGCAGTGGCCTGG - Intergenic
921156848 1:212445661-212445683 TAAGAGACACTGCTGTGGGGGGG - Intronic
921551293 1:216538446-216538468 AAAGACAGACAGTAGTGGGGTGG - Intronic
922208460 1:223469069-223469091 ACAGAGAAAAAGAAGTGGGGAGG + Intergenic
922578211 1:226677428-226677450 AGAGAGAGACAGCAGAGGGGTGG + Intronic
922983266 1:229846829-229846851 ACAGAGAGAATGCACTGTGCAGG - Intergenic
923978958 1:239298414-239298436 GCAGGGGGACTGGAGTGGGGAGG - Intergenic
924807187 1:247370953-247370975 TCAGAGAGACAGCAGTATGGGGG - Intergenic
924921079 1:248629705-248629727 ACAGACAGACTGGAGTCGGCGGG - Intergenic
1064753436 10:18554706-18554728 GAAGAGAGAATGCAGTGGAGTGG + Intronic
1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG + Intronic
1068348581 10:55814537-55814559 CCAAAGAGACTGGAGTGGAGTGG - Intergenic
1069621794 10:69841813-69841835 GCAGAGACCCTGCAGTGGGAAGG + Intronic
1070813586 10:79310457-79310479 ACAGACAGACAGCATTGGGCGGG - Intronic
1071465987 10:85940094-85940116 AGAGAGAGACAGCTGTGGGCAGG + Intronic
1071841664 10:89477880-89477902 ACAGAGGGACTTCATCGGGGTGG - Intronic
1073150930 10:101311004-101311026 AAAGAAAGACTGAAGTGGGTGGG - Intergenic
1073351492 10:102823049-102823071 ACAGAGGCCGTGCAGTGGGGTGG - Intergenic
1074492537 10:113952046-113952068 ACAGAGAGACACCAGTGATGCGG - Intergenic
1076036362 10:127201739-127201761 AAGGAGAGGCTGCAGTTGGGAGG - Intronic
1076167446 10:128293902-128293924 ACAGGGAGGCGGAAGTGGGGAGG - Intergenic
1077096186 11:800103-800125 ACTGAGGGACAGCAGAGGGGCGG - Intronic
1077197248 11:1287704-1287726 GCAGAGAGGGTGCAGCGGGGAGG - Intronic
1077551856 11:3204014-3204036 ACAGAAAGCCTGAATTGGGGAGG - Intergenic
1077785704 11:5381122-5381144 ACAGAGAGAGAGAGGTGGGGTGG - Intronic
1078030546 11:7746702-7746724 ACAAAGTGACTGCAGTGAGGTGG - Intergenic
1078037754 11:7825222-7825244 ACAGAGTGACTGCAGTGAGGTGG + Exonic
1078609557 11:12808605-12808627 ACAAATAGAGGGCAGTGGGGAGG - Intronic
1079062006 11:17257157-17257179 AGAGAGAGACTGTCGGGGGGTGG + Intronic
1079137596 11:17784762-17784784 TCAGAGTGACTGCAGTGCGGAGG - Intergenic
1079250899 11:18786840-18786862 AAAAAGAGAAGGCAGTGGGGAGG - Intronic
1080155608 11:29107046-29107068 AGAGAGAGAGTGACGTGGGGAGG - Intergenic
1081640181 11:44747685-44747707 AGAGAGAGACGGGAGGGGGGAGG - Intronic
1081751172 11:45512182-45512204 AGGGATAGACTGCAGTGGGCAGG + Intergenic
1082896074 11:58191219-58191241 AAAGAGCGACGGCAGTGAGGTGG - Exonic
1083424417 11:62575702-62575724 ACAGAAAAACTGCTGTGAGGAGG - Exonic
1083919876 11:65776737-65776759 ACAGAAAGACAGCAGTGGCCAGG - Exonic
1084185235 11:67467933-67467955 AGAGAGTGAGTGAAGTGGGGTGG + Intronic
1084695396 11:70750605-70750627 TCAGGGAGACTGTAGTGAGGAGG + Intronic
1084923036 11:72487329-72487351 TCACTGACACTGCAGTGGGGAGG - Intergenic
1085050993 11:73380175-73380197 GCACAGAGACGGCAGTGGGAGGG - Intronic
1087130052 11:94661104-94661126 AGAAAGAGACTCCAGTGAGGCGG - Intergenic
1087632679 11:100669335-100669357 TCCGAGATGCTGCAGTGGGGTGG - Intergenic
1087742274 11:101901569-101901591 ACAGAGAAAAGGCAGTGTGGAGG + Intronic
1087870809 11:103290677-103290699 ACAGAGAGATAGGAGTAGGGGGG - Intronic
1089792611 11:120955606-120955628 TCAGAGAGACGCCAGTGGTGAGG + Intronic
1090609906 11:128461818-128461840 AAAGATGGACTTCAGTGGGGAGG - Exonic
1090844925 11:130522483-130522505 ACAGAGGGACAGCAGGAGGGAGG + Intergenic
1091081507 11:132673344-132673366 ACAGAGAGATGGAAGTGGGTGGG + Intronic
1091119015 11:133041444-133041466 GCAGAGAGACTGCAGAGGGTGGG - Intronic
1091915759 12:4271163-4271185 ACAGAGAAATTCCAGCGGGGAGG - Intergenic
1092276781 12:7067499-7067521 ACAGAGAGGCTGGTGTGGGGAGG + Intronic
1093816337 12:23553018-23553040 AAAAAGAGACTTCAGTGGAGTGG - Intronic
1094174071 12:27524085-27524107 AAAGAGAGTCAGCAGTGGGGCGG - Intronic
1094240080 12:28212305-28212327 TCAAAGAGACTCCAGTGTGGTGG + Intronic
1095133565 12:38571541-38571563 CCAGAGACACTGGACTGGGGTGG + Intergenic
1098907845 12:76180106-76180128 ACAGAAAGGCTGGGGTGGGGTGG + Intergenic
1099781549 12:87202209-87202231 AAAGAGACACTGAAGTGGGTAGG + Intergenic
1100863338 12:98830411-98830433 TGAGAGAGACTGGAGTGGGATGG - Intronic
1101034532 12:100692373-100692395 AGAGAGAGAGAGAAGTGGGGGGG - Intergenic
1101273336 12:103171896-103171918 ACAGAAAGACTAAAGTGGTGGGG + Intergenic
1101818838 12:108167386-108167408 ATTGAGAGATTGGAGTGGGGTGG - Intronic
1101837329 12:108304636-108304658 ACAGGGAGACTGCAGAGAGATGG - Intronic
1102099247 12:110265172-110265194 AAAGACAGACTGCAGAGGGAAGG + Intergenic
1103513353 12:121490315-121490337 GCAGAGAGGCTGGAGTGTGGAGG - Intronic
1103742616 12:123101322-123101344 ACAGTGAGAGAGGAGTGGGGAGG - Intronic
1104083781 12:125456699-125456721 ACAGAGAGACTGCAGTGGGGAGG - Intronic
1104286988 12:127432570-127432592 ACAGAGAGACTGCAGGGAGGAGG + Intergenic
1104770239 12:131357060-131357082 CCAGAGAGACTGTGGTGGAGAGG - Intergenic
1104876438 12:132038234-132038256 ACAGAAAGAAGGGAGTGGGGAGG - Intronic
1104974887 12:132547972-132547994 ACAGAGAGACAGAAGTGAGTCGG - Intronic
1105210757 13:18255482-18255504 AGAGAGTGAATGGAGTGGGGTGG + Intergenic
1105584189 13:21728941-21728963 ACAGAGAGACTGCAAAAGAGGGG - Intergenic
1105614634 13:22000745-22000767 TCCTAGACACTGCAGTGGGGTGG + Intergenic
1107976478 13:45693309-45693331 ACAGAGGGACTTCAATGGGGTGG + Intergenic
1108056074 13:46486732-46486754 CAAGCGAGACTGCAGTGGGCAGG - Intergenic
1108192927 13:47961268-47961290 AAAGAGAAAATGGAGTGGGGGGG + Intronic
1108209544 13:48124476-48124498 ACAGAGAGATTACTGTGGGCTGG - Intergenic
1108261228 13:48658731-48658753 AGAGAGAGCCTGCAGTGTTGGGG + Intronic
1108273673 13:48787215-48787237 AGAGAGGGACAGCAGTGTGGAGG - Intergenic
1109010886 13:56942617-56942639 CCAGAGAGACTGCAGTGGAGAGG + Intergenic
1110381412 13:74855832-74855854 TCAGTGAGTCTGCAGTGGTGGGG - Intergenic
1110621438 13:77600127-77600149 AGAAAGAGACTTCAGTGGTGAGG - Intronic
1110696005 13:78490371-78490393 TCAGAGAGACTCCAGTGCGGTGG + Intergenic
1110935612 13:81284125-81284147 AAAGAGAGAATGCAGGGGGTGGG - Intergenic
1111080026 13:83293266-83293288 AGAAAGTGACTGCAGTGTGGTGG - Intergenic
1111255638 13:85663764-85663786 AAAGAGAGATTGCAGTGACGGGG - Intergenic
1111618595 13:90694365-90694387 TGAGAGAGGCTGCAGTGGGTTGG + Intergenic
1112001109 13:95210906-95210928 AGAGAGAGGGGGCAGTGGGGGGG - Intronic
1113476008 13:110581919-110581941 CCACTGACACTGCAGTGGGGTGG + Intergenic
1113562287 13:111291375-111291397 GCAGAGGGTCTGCATTGGGGTGG + Intronic
1113633964 13:111907437-111907459 ACAGAAAGCGTGGAGTGGGGCGG + Intergenic
1113851861 13:113422428-113422450 ACAGAGGGTCTGCAGCGGGGGGG + Intronic
1114028464 14:18553020-18553042 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1115097183 14:29650553-29650575 CCAGAGAGACTGAATGGGGGGGG + Intronic
1115128692 14:30026776-30026798 ACAGAGTGTGTGGAGTGGGGAGG - Intronic
1117299723 14:54412748-54412770 ACAGAGAGCCAGCCATGGGGAGG + Intronic
1118347587 14:64951186-64951208 ACAGAGAGAGTGCAGTCATGGGG + Intronic
1118609920 14:67532335-67532357 ACAGAGAGCCTGCAGGGTTGAGG + Intronic
1118665802 14:68067890-68067912 TCAGACAGACTGCAGTGCAGTGG - Intronic
1118667733 14:68088641-68088663 ACAGAGAGAGAGAGGTGGGGGGG + Intronic
1119773430 14:77235434-77235456 CCAGGGGGACTGCAGTGGGTGGG + Intronic
1119773487 14:77235610-77235632 CCAGGGGGACTGCAGTGGGTGGG + Intronic
1119976383 14:79028930-79028952 ACAGAGAGAAAGCATTGGGATGG + Intronic
1120552882 14:85892754-85892776 ACACAGAGACTGCATTTGAGAGG - Intergenic
1121105977 14:91280008-91280030 CCTGAAAGTCTGCAGTGGGGTGG - Intronic
1121676846 14:95760424-95760446 CCAGAGAGACTGTGGTGGGAGGG + Intergenic
1121717952 14:96089643-96089665 GCAGAGAGAGAGCAGTGGGCGGG - Exonic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1124981363 15:34570696-34570718 ACAGAGAGACTGAAGCAAGGTGG + Intronic
1125501340 15:40241752-40241774 ACAGGGAGGGTGCAGTGGGTGGG + Intronic
1126308432 15:47288002-47288024 AGAGAGAGAGTGCAGCGGGGTGG + Intronic
1126558669 15:50019676-50019698 CCAGAGAGATTGCAGTTGGAAGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127896462 15:63304046-63304068 ATAAAGAGAATGCAGTGAGGAGG - Intronic
1129002623 15:72346923-72346945 ACAGGGAGGCTGCAGAGGGACGG - Intronic
1129804774 15:78446653-78446675 ACAGAGAGACTGAACTGGAAAGG - Intronic
1130028448 15:80290234-80290256 ACAAAGGAAATGCAGTGGGGAGG + Intergenic
1131228318 15:90643043-90643065 ACAGAGACACAGCTCTGGGGAGG - Intronic
1131251149 15:90830881-90830903 GCAAAGAAACTGCAGAGGGGAGG + Intergenic
1131449467 15:92527459-92527481 ACAGAGGGACTTCAGGTGGGTGG - Intergenic
1131685925 15:94767500-94767522 AAAGAGAGACAGGAGAGGGGAGG + Intergenic
1131830050 15:96348425-96348447 CCAGAGAAAATGTAGTGGGGAGG - Intergenic
1132265912 15:100470514-100470536 TCAGAGTGACTGTAGTGGAGTGG + Intronic
1132774860 16:1587719-1587741 CCCGAGGGAGTGCAGTGGGGCGG + Intronic
1135285539 16:21189613-21189635 ACAGAAAGACTGCAGTGCTGGGG + Intergenic
1138386836 16:56641301-56641323 GCACAGAGACAGCAGTGGGAAGG - Intronic
1139212345 16:65091966-65091988 CCAGAGAGACTTCTCTGGGGAGG - Intronic
1140289763 16:73642286-73642308 CCAGAAAGACTGCAGAGGAGAGG - Intergenic
1140301720 16:73764428-73764450 AAAGAAAGACTGCAGAGGGGAGG + Intergenic
1140638941 16:76949219-76949241 AGAGAGAGACAGCAGGGGCGTGG + Intergenic
1141562551 16:84879107-84879129 AGAGAAAGCCTGAAGTGGGGTGG - Intronic
1141871467 16:86789348-86789370 ACTGAGAGAGTGAAGTGGAGTGG - Intergenic
1142010544 16:87711755-87711777 ACAGAGGGGCTTCTGTGGGGAGG + Intronic
1142255239 16:89010732-89010754 ACAGAGCCACTGCAGTGAAGGGG + Intergenic
1142274813 16:89112838-89112860 GCAGAGAGACTGCATAGGAGAGG - Intronic
1142688954 17:1593294-1593316 GCAGAGAAACCTCAGTGGGGAGG + Intronic
1142753588 17:2002686-2002708 AGAGAGAGACGGGCGTGGGGAGG - Intronic
1144373772 17:14618804-14618826 AGACAGAGACTGCAGTGTGCAGG - Intergenic
1144795229 17:17886825-17886847 AGAGACAGACTGGAGTGGGAGGG + Intronic
1145786037 17:27594488-27594510 AGAGAGAGAGTGCTGTGAGGAGG - Intronic
1147427192 17:40351504-40351526 CCAGGGAGACTGCAGCTGGGAGG + Intronic
1149389455 17:56174488-56174510 ACAGAGAGACTCCATGGAGGGGG - Intronic
1149656863 17:58314502-58314524 AGATAGAGACTGGAGTGAGGTGG + Intronic
1149855342 17:60078181-60078203 TCAGAAAGACGGCAGAGGGGAGG + Intronic
1151577328 17:74959263-74959285 ACAGAGAGTCTGCAGTCTAGTGG - Intronic
1152390449 17:80001080-80001102 ACAGTGAGACTGCTGGGGCGAGG + Intronic
1152571971 17:81124912-81124934 ACAGAGTGAGTGGGGTGGGGTGG - Exonic
1152751231 17:82063315-82063337 GCAGAGAGGCTGCTGTGGGCAGG + Intronic
1152921721 17:83069224-83069246 GTAGAGAGAATGCAGCGGGGTGG + Intergenic
1153481709 18:5553942-5553964 ACAGAGTGCCTGGAGTGGGACGG - Intronic
1153922722 18:9805657-9805679 GCAGAGAAACTGGAGTGTGGTGG - Intronic
1154052305 18:10972470-10972492 AGTGAGAGACTGCGGTGGAGAGG + Intronic
1154374816 18:13800424-13800446 GCAAAGTGACTGCAGTGCGGCGG - Intergenic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1155802597 18:30127680-30127702 AGAGAGAGAGTGCAGGGGCGAGG - Intergenic
1157228150 18:45887255-45887277 ACCGGGACACAGCAGTGGGGAGG + Intronic
1157258197 18:46156940-46156962 AGAGAGGGACTACAGAGGGGAGG - Intergenic
1157543840 18:48533877-48533899 AGAGAGAGACAGAGGTGGGGAGG + Intergenic
1159113826 18:64090674-64090696 AAAGAGAGACTGCAGAGGAAAGG - Intergenic
1159688193 18:71449873-71449895 ATAAAGAGACTACAATGGGGGGG - Intergenic
1161586140 19:5106885-5106907 GCAGAGAGCCTGCAGTTGGTGGG + Intronic
1161588290 19:5117331-5117353 AGGGAGGGACTGCAGTGGGTGGG + Intronic
1161998689 19:7730217-7730239 ACCGAGAGGATGCAGTGGGTAGG + Intronic
1162494937 19:11018342-11018364 GCAGGCAGAATGCAGTGGGGAGG - Intronic
1162767810 19:12930533-12930555 AAAGAGAGGCTGCAGTGAGTGGG + Intronic
1163003857 19:14385310-14385332 ACAGAGAGACAGAAGGTGGGGGG - Intronic
1163220145 19:15913207-15913229 ACAGAGAGAACGCACTGGGAGGG + Exonic
1163648611 19:18504191-18504213 ACAGAGAGGCTGGAGGGGTGAGG + Intronic
1164432546 19:28200740-28200762 ACCCAGAGGCTTCAGTGGGGAGG - Intergenic
1164631844 19:29766999-29767021 ACAAAGACACTGCAGTAAGGTGG + Intergenic
1165109565 19:33493823-33493845 ACAGAGAGTGGGCTGTGGGGTGG - Intronic
1165244333 19:34489466-34489488 ACAGAGTGGCTGCAGAGGGGTGG + Intronic
1166060695 19:40323679-40323701 ACTGACAGACTGCAATGGGGAGG + Intronic
1168450549 19:56463064-56463086 GCAGAGTGAGTGCAGCGGGGAGG + Intronic
925046145 2:774120-774142 ACAGGGTGCCTGCTGTGGGGAGG - Intergenic
925160153 2:1677883-1677905 AGTGAGTGCCTGCAGTGGGGCGG + Intronic
925357977 2:3255960-3255982 ACAGAGATCCTGCATTCGGGCGG + Intronic
925657442 2:6165171-6165193 AATGAGAAACTGCAGTGGGGAGG - Intergenic
925782010 2:7389719-7389741 TGAGAGGGACTGCAGTGGAGGGG + Intergenic
928413475 2:31071986-31072008 ACAGTGAGGCTGCAGGGTGGGGG + Intronic
929484339 2:42340775-42340797 ACAGTCAGAGTGCAGTGGAGCGG - Intronic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
929941510 2:46337447-46337469 CCCTAGAGACTGAAGTGGGGCGG + Intronic
931168001 2:59770737-59770759 AAAGAGAGAATGGTGTGGGGAGG - Intergenic
931170233 2:59795402-59795424 AGAGAGAGACTGTGTTGGGGAGG - Intergenic
932165003 2:69498030-69498052 GCAGAGAGACATGAGTGGGGTGG - Intronic
932757099 2:74416443-74416465 ATAAAGAAACTGAAGTGGGGAGG + Intronic
932961117 2:76413793-76413815 ACAGTGAGACTGCATTGCAGTGG + Intergenic
933611106 2:84436396-84436418 ACAGAAAGACTGCCTTGGGATGG + Intronic
934479070 2:94618479-94618501 GCAGAGAGAGTGCACTGCGGTGG + Intergenic
934502799 2:94872819-94872841 ACTGAGAGAGTGCAGGGGGAAGG - Intronic
934980200 2:98833286-98833308 ACAGCAAGCCTGCAGAGGGGAGG + Intronic
935810562 2:106793178-106793200 ACAGAAAGAGTGAAGAGGGGAGG + Intergenic
936690117 2:114876922-114876944 AGAGAGAGACTGCAGAGGAAAGG - Intronic
937476879 2:122223535-122223557 ACAGAAAGACTGAAGTTGGTTGG + Intergenic
938133896 2:128738174-128738196 AAAGAGGGACAGCAGTGGGACGG - Intergenic
938586838 2:132699174-132699196 AAAGAGAGAGTGCAGAGTGGAGG - Intronic
938632330 2:133180442-133180464 CTACGGAGACTGCAGTGGGGAGG - Intronic
939167158 2:138652335-138652357 ACAGTGACACTGCAGTGGGCAGG + Intergenic
939422248 2:141987438-141987460 TCAGAGATAATGCAGTGGGAAGG - Intronic
941043592 2:160649002-160649024 GCAGACAGACTACTGTGGGGAGG + Intergenic
941366783 2:164620081-164620103 AGAGAGAGAAGGCGGTGGGGGGG - Intronic
942512247 2:176715010-176715032 CAAGAGAGAGTGCAGCGGGGAGG - Intergenic
943170183 2:184387348-184387370 ACAGAGAGACTCCAGTTGTTTGG + Intergenic
945223326 2:207506564-207506586 AAAAAGAGCATGCAGTGGGGAGG - Intergenic
945578813 2:211566326-211566348 ACAGGGAGACTGCAGCTGGAAGG + Intronic
946203788 2:218089016-218089038 ATAGAGACACAGCAATGGGGAGG - Intronic
946486949 2:220109889-220109911 ACAGAGAGACCGCTGTGGAGAGG + Intergenic
946606229 2:221408486-221408508 CCAGGGAGAAGGCAGTGGGGTGG - Intergenic
946651551 2:221897010-221897032 GCAGAGAGTCTGCTGTGGTGTGG + Intergenic
947631467 2:231656176-231656198 ACAGCAAGACAGGAGTGGGGAGG + Intergenic
948778060 2:240300181-240300203 AGAGAGAGAGAGAAGTGGGGCGG + Intergenic
948875343 2:240823987-240824009 ACTGGCAGCCTGCAGTGGGGAGG + Intergenic
1168858504 20:1027956-1027978 ACAGAGAGACTCCCCTGGGTTGG - Intergenic
1170423120 20:16212078-16212100 AGAGAGAGAATGCAGGGGAGAGG + Intergenic
1171291899 20:23987171-23987193 AGAGAGTGAATGGAGTGGGGTGG + Intronic
1171448100 20:25218736-25218758 GCAGCGGGACAGCAGTGGGGTGG - Intronic
1171774213 20:29350432-29350454 ATGGAGAGACTGCAGGGGGCAGG - Intergenic
1171816233 20:29788050-29788072 ATGGAGAGACTGCAGGGGGCAGG - Intergenic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1172696871 20:36828976-36828998 ACAGAGACACTGGCTTGGGGGGG + Intronic
1173459760 20:43233774-43233796 ACACAGTGACTGCATTGGGCAGG - Intergenic
1173569594 20:44067755-44067777 AGAGGGAGAGTGCAGTGAGGAGG + Intronic
1174252323 20:49228917-49228939 CCTGAGAGACTGTGGTGGGGTGG + Intronic
1174687743 20:52471878-52471900 ACAAACACACTTCAGTGGGGTGG - Intergenic
1175171206 20:57082657-57082679 ACAGAGTGGCTGGGGTGGGGAGG + Intergenic
1175943413 20:62548116-62548138 AAAGGGAGACCGCAGTGGGTAGG - Intergenic
1176114838 20:63427627-63427649 AGAGAGAGACTGAAGTGATGCGG - Intronic
1176162203 20:63653584-63653606 AGAGAGAGACTGCGGGGGCGGGG + Intergenic
1178849796 21:36203629-36203651 AAAGGGAGGGTGCAGTGGGGGGG + Intronic
1178903568 21:36616957-36616979 GCAGCGAGGCTGGAGTGGGGGGG + Intergenic
1178977219 21:37230669-37230691 ACAGAAACACTTCACTGGGGTGG - Intronic
1179953958 21:44727565-44727587 CCAGAGAGGCTGCAGCGGAGGGG - Intergenic
1180300350 22:11032087-11032109 ACAGAGAGACAGGGGAGGGGGGG - Intergenic
1180319678 22:11308585-11308607 ACGGAGAGACTGCAAGGGGCAGG - Intergenic
1180452587 22:15480072-15480094 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1180765498 22:18343935-18343957 AGAGAGTGAATGGAGTGGGGTGG - Intergenic
1181125250 22:20698186-20698208 ACAGTGAGACGGGGGTGGGGTGG + Intergenic
1181187900 22:21119513-21119535 ACAGTGAGACGGGGGTGGGGTGG - Intergenic
1181211298 22:21290980-21291002 ACAGTGAGACGGGGGTGGGGTGG + Intergenic
1181293838 22:21819070-21819092 ACAGAGTGCCTGCAGAGAGGCGG + Intronic
1181398205 22:22635907-22635929 ACAGTGAGACGGGGGTGGGGTGG - Intergenic
1181400046 22:22645764-22645786 AGAGAGTGAATGGAGTGGGGTGG - Intronic
1181489155 22:23250890-23250912 ACAGAGAGGTAGCAATGGGGAGG + Intronic
1181625168 22:24118219-24118241 ACTGAGGGAGAGCAGTGGGGTGG + Intronic
1181649318 22:24250026-24250048 AAAGAGTGAATGGAGTGGGGTGG + Intergenic
1181651206 22:24260153-24260175 ACAGTGAGACGGGGGTGGGGTGG + Intergenic
1181702020 22:24626862-24626884 AGAGAGTGAATGGAGTGGGGTGG - Intronic
1181706172 22:24650586-24650608 ACAGTGAGACGGGGGTGGGGTGG - Intergenic
1183198386 22:36368990-36369012 ACAGAGGGGCTGCAGAGGGGTGG - Intronic
1183514667 22:38257909-38257931 GCAGAGAGATTGCAGAGGAGAGG - Intronic
1184404400 22:44291952-44291974 ATAGAGAGACTGCAGAGAGAGGG - Intronic
1184733676 22:46385462-46385484 ACAGTGAGCCTGGAGTGAGGCGG + Intronic
1184809037 22:46816213-46816235 ACAGACAGCTTCCAGTGGGGAGG - Intronic
1185294242 22:50045543-50045565 ACAGAGACACTGCAGGGAGAAGG - Intronic
1203215651 22_KI270731v1_random:4451-4473 ACAGTGAGACGGGGGTGGGGTGG - Intergenic
949321798 3:2819774-2819796 CCAGGTACACTGCAGTGGGGTGG - Intronic
953284884 3:41596994-41597016 ACAGAGAGACTGGGGTGGGATGG - Intronic
954616151 3:51969667-51969689 AGGAAGAGACTGAAGTGGGGAGG - Intronic
955050025 3:55401303-55401325 AGAAAGATACCGCAGTGGGGAGG + Intergenic
955831504 3:63009222-63009244 AAAGAGAGACAAAAGTGGGGTGG + Intergenic
956275771 3:67499596-67499618 AGGGAGAGACTGCAGTGGAGAGG + Intronic
957986147 3:87574597-87574619 TCAGAGAGACTTCAGGGTGGCGG - Intergenic
958475592 3:94576791-94576813 AGAGAGAAAGCGCAGTGGGGAGG - Intergenic
958868124 3:99525145-99525167 GCAGAGACTCTGCAGAGGGGTGG - Intergenic
959080391 3:101794726-101794748 ACAGAGAGACTTGAGAGGGTAGG + Intronic
959758748 3:109930806-109930828 AGAGAGGGAGTGGAGTGGGGTGG - Intergenic
960412432 3:117344055-117344077 AGAGAGAGAAAGAAGTGGGGAGG - Intergenic
960989998 3:123304154-123304176 GGAGAGGGTCTGCAGTGGGGAGG + Exonic
961409180 3:126705903-126705925 ACAGAGAGAGTGCTTTGTGGAGG + Intronic
961663560 3:128482973-128482995 ACAGAGGGACTGCAGCCGCGGGG + Intronic
961781848 3:129325093-129325115 ACAGGGACTCTGCGGTGGGGCGG + Intergenic
962525536 3:136234469-136234491 ACAGAGAGAGTAAAGTTGGGTGG + Intergenic
963638423 3:147828574-147828596 TCAGTGATACTGCAGTGTGGAGG + Intergenic
965540320 3:169865344-169865366 ACAGCTAGGCTGGAGTGGGGTGG + Intronic
965568823 3:170150808-170150830 AAAGAGACATTGGAGTGGGGTGG + Intronic
966255958 3:177917329-177917351 ACATACGGGCTGCAGTGGGGAGG + Intergenic
967597274 3:191341566-191341588 ACTGAGAGACTCCAGTGAGGAGG - Intronic
967954297 3:194865931-194865953 ACAGGGACACTGCAGTGCTGTGG + Intergenic
968462746 4:733424-733446 ACAGAGAGAAGCCAGTGCGGGGG + Intronic
968628629 4:1638948-1638970 AGAGAGTGACTGCAGGGAGGGGG + Intronic
968817951 4:2831480-2831502 ACACAGAGGGTGGAGTGGGGAGG + Intronic
969238154 4:5881467-5881489 ACAGTCACACTGCAGTGGGAGGG - Intronic
969652187 4:8474407-8474429 ACAGAGAGGCAGCCGTGGGAGGG + Intronic
969686835 4:8680282-8680304 AGAGAGAGACAGCAGAGGGAGGG + Intergenic
970299681 4:14668112-14668134 ACAGAGAGACTGTTGTGAGAAGG - Intergenic
970579707 4:17464095-17464117 AAAGGGAGACTGGAGTAGGGTGG - Intronic
970838689 4:20441506-20441528 AGAGAGAGACAGAAGTGGGGGGG - Intronic
971943580 4:33245824-33245846 ACAGAGAGTCCCCACTGGGGTGG - Intergenic
972101744 4:35428748-35428770 AAAGAGAGGCTGGAGTGAGGTGG - Intergenic
972410836 4:38792919-38792941 CTAGCGAGACTGCAGTGGGATGG - Intronic
973702429 4:53550583-53550605 ACAGTGAAAATGAAGTGGGGAGG + Intronic
976720935 4:88168053-88168075 AGAGAGAGACAGCATCGGGGAGG + Intronic
977564979 4:98571363-98571385 ACAGGGTTACTGCAGGGGGGTGG + Intronic
978525612 4:109662015-109662037 AGAGTGAGACTGCATTGAGGTGG + Intronic
979437305 4:120708803-120708825 GGAGAGAGATTGGAGTGGGGTGG + Intronic
979723267 4:123928791-123928813 ACAAAGAGACTTGAGTGTGGAGG + Intergenic
981733210 4:147921767-147921789 ACACAGAGACGGCAGGTGGGAGG - Intronic
982654418 4:158129799-158129821 ACTAAGAGACTGCGGTAGGGTGG - Intronic
982808991 4:159802921-159802943 AAAGAGAGACTGCAGAGGCATGG - Intergenic
983037142 4:162881053-162881075 ATTGAGAGACAGGAGTGGGGAGG - Intergenic
983866949 4:172778963-172778985 AGAGAGAGAGTGAAGGGGGGTGG - Intronic
985487036 5:157832-157854 ATGGAGAGGCAGCAGTGGGGTGG + Intronic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
985577100 5:678581-678603 TCAGAGGCTCTGCAGTGGGGAGG - Intronic
985592019 5:770634-770656 TCAGAGGCTCTGCAGTGGGGAGG - Intergenic
985954410 5:3252589-3252611 CCAGAGAGAAGCCAGTGGGGAGG + Intergenic
986008358 5:3687214-3687236 ACATAGAGAGAGGAGTGGGGTGG + Intergenic
986019977 5:3792076-3792098 TCAGAGAGACTTGAGAGGGGTGG + Intergenic
989168642 5:38454099-38454121 ACAGAGTGGCAGCAATGGGGCGG - Intronic
992428316 5:76681662-76681684 ACAGAGAGGCTGGAGTATGGCGG + Intronic
992619094 5:78574892-78574914 ACAGAGAGACTGAGGTGGTGAGG - Intronic
993522845 5:88925447-88925469 ACAGAGAGACTGTCGGAGGGGGG + Intergenic
995930876 5:117441343-117441365 ACAGAGAGACTCCAGGGTTGAGG + Intergenic
997265686 5:132493966-132493988 ACACAGAGATTGAAGTGGTGGGG - Intergenic
997387668 5:133486394-133486416 AAAGAGAGACGGCAGAGGAGGGG + Intronic
997417189 5:133738162-133738184 ACAGAGAGAGTGATGTTGGGAGG - Intergenic
997652695 5:135534466-135534488 AGAGCGAGTCTGCAGTGGTGGGG + Exonic
999247137 5:150161172-150161194 GCAGAGAGCCGGCAGTGGGATGG + Intergenic
999664480 5:153898392-153898414 ACAGAGAGGCAGCAGTGGGCAGG + Intergenic
999857301 5:155608709-155608731 ACAGAGAGACTGGAGTCCTGGGG + Intergenic
1000302851 5:159971865-159971887 ACAAGGAGCCTGCAGTGGGGAGG - Exonic
1000542346 5:162555660-162555682 ACAGAGTGACTGCAGAGGCATGG - Intergenic
1001379625 5:171295546-171295568 ACAGAAAGACTGAAATGGGAGGG - Intronic
1002451870 5:179323361-179323383 ACAGAGAGAATACTTTGGGGAGG + Intronic
1002586187 5:180250130-180250152 ACACAGAGTCAGCACTGGGGAGG - Intronic
1002597275 5:180332293-180332315 ATTGAGAAAATGCAGTGGGGTGG - Intronic
1002642390 5:180636419-180636441 TCAGAGGGACTGCTGTAGGGAGG - Intronic
1003322968 6:5068672-5068694 ACAGAGAGAAAGCAGAGGAGGGG + Intergenic
1003709758 6:8576225-8576247 ATAGTGAGACTGCAGTGTGCTGG - Intergenic
1004140352 6:13012498-13012520 TCAGAGTGAATGCAGTAGGGTGG + Intronic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1004777462 6:18863819-18863841 AGAGAGAGCATGGAGTGGGGAGG - Intergenic
1006121075 6:31806383-31806405 ACTGAGAGAGCACAGTGGGGAGG - Intronic
1006408121 6:33856836-33856858 AGAGAGAGGCCTCAGTGGGGTGG - Intergenic
1006474925 6:34247498-34247520 ACAGAGACACAGCACTGTGGGGG + Intronic
1006932060 6:37694516-37694538 ACAGAAAGACTGCTGGGGAGGGG + Intronic
1007069219 6:39022768-39022790 ACAGCAAGACTGCAGGGGTGTGG - Intronic
1008046931 6:46860614-46860636 ACAGAGAAGCTGCAATGGGGAGG + Intronic
1009409776 6:63352619-63352641 AGAGACAGACTGGAGTGCGGTGG - Intergenic
1009934898 6:70222591-70222613 ACAGAGATACAGCATTGGAGAGG + Intronic
1010408490 6:75533798-75533820 ACAGAGAGAATGGAGCTGGGGGG + Intergenic
1010517598 6:76791695-76791717 AGAGAGAGACAGCAGTGGGGAGG + Intergenic
1011157044 6:84344451-84344473 AAAGAGAGACAGTTGTGGGGAGG - Intergenic
1011197898 6:84801062-84801084 ACAGGAAGACTGCAGTGAGGTGG + Intergenic
1012207305 6:96477616-96477638 ACACTGGGCCTGCAGTGGGGTGG - Intergenic
1013460617 6:110371753-110371775 AAAGAGAGAAAGCAGTGAGGAGG - Intergenic
1013638506 6:112051143-112051165 TCAGTGAGACTGCAGAGGGATGG + Intergenic
1013771312 6:113631148-113631170 ACAGTGTGGGTGCAGTGGGGAGG - Intergenic
1015915333 6:138210440-138210462 ACAGAAAGACCACAGTTGGGAGG + Intronic
1015990502 6:138936572-138936594 AGAGAGAGACGGCAGGGTGGGGG + Intronic
1016889814 6:148994786-148994808 AAAGAGAAACTGCAGTGAGCAGG - Intronic
1017605582 6:156129099-156129121 AGAGAGAGAGAGAAGTGGGGTGG - Intergenic
1017644299 6:156524942-156524964 ACTGAGATACTAAAGTGGGGTGG + Intergenic
1017751247 6:157492210-157492232 ACAGGGAGACTACAGTGGCTGGG - Intronic
1018131511 6:160736218-160736240 ACAGAGAGAAGGCAGGGAGGAGG + Intronic
1018265762 6:162023159-162023181 CCCGAGACACTGCTGTGGGGTGG - Intronic
1019079249 6:169418525-169418547 AGAGACAGACAGAAGTGGGGAGG + Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019501095 7:1365095-1365117 CCAGAGGGGATGCAGTGGGGAGG - Intergenic
1019526985 7:1484916-1484938 ACAGAGACCCTGCCCTGGGGAGG - Intronic
1019999939 7:4749913-4749935 GCAGGGAGACTGCAGAGGGACGG - Intronic
1020403599 7:7805264-7805286 ACAGAGAGGCTCCAGGGTGGTGG - Intronic
1022305874 7:29146274-29146296 AGAGTGAGACTGGAGTGGGGTGG - Intronic
1023611887 7:41980188-41980210 ACACAGAAACTGCAGTGGTTGGG + Intronic
1023826518 7:44013703-44013725 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1024058600 7:45682194-45682216 ACAGAGAAGCTGCATGGGGGTGG + Intronic
1024276817 7:47684231-47684253 GCACAGAAACTGCAGTGTGGTGG + Intergenic
1024306737 7:47935543-47935565 ACTCGGAGACTGCAATGGGGGGG + Intronic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1025035675 7:55591335-55591357 GCAGGGAGGCAGCAGTGGGGTGG - Intergenic
1026090096 7:67292573-67292595 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1026679255 7:72452869-72452891 ACAGAGACTCTGCAATGTGGGGG + Intergenic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1027119687 7:75507891-75507913 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1027272138 7:76527720-76527742 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1027863123 7:83611106-83611128 GCAGAGAGACAGCAGGGTGGAGG - Intronic
1028774192 7:94658636-94658658 GCAGAGAAACCGCAGGGGGGCGG - Intronic
1029463523 7:100710703-100710725 GCAGAGAGATCACAGTGGGGCGG + Intergenic
1029717810 7:102342136-102342158 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1029754805 7:102567107-102567129 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1029772755 7:102666187-102666209 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1031297152 7:120015076-120015098 ACAGAAAAACTGCAGTGGGCAGG + Intergenic
1033151415 7:138918037-138918059 ACAGAGAGGCGGCCGTGGGCAGG + Exonic
1034285714 7:149881925-149881947 AAAGTCAGACTGCAGTGGGCTGG + Intergenic
1034426379 7:151016357-151016379 ACATGGAGACTGAGGTGGGGTGG - Intronic
1034652381 7:152701698-152701720 ACAGGGAGACTGAAGAAGGGTGG - Intergenic
1034827767 7:154282180-154282202 ACAGAGAGAATGGAATAGGGAGG - Intronic
1037414236 8:18631771-18631793 AGAGAAACATTGCAGTGGGGTGG - Intronic
1038462861 8:27731019-27731041 ACAGAGGGCCTGCAGGGAGGAGG + Intergenic
1038545173 8:28420572-28420594 AGAGAGAGACAGCTGTGGGAAGG - Intronic
1039334542 8:36574994-36575016 ACAGACAGGCTGCAGTCGTGTGG - Intergenic
1041306086 8:56462554-56462576 AGTGAGAACCTGCAGTGGGGAGG + Intergenic
1042751093 8:72158464-72158486 AGTGAGAGACTGGAGTGGTGGGG - Intergenic
1043395026 8:79827630-79827652 ACACACAGCCTGCAGAGGGGAGG - Intergenic
1045055879 8:98368070-98368092 AGAGAAAAACAGCAGTGGGGAGG + Intergenic
1045411605 8:101926099-101926121 TCAGACAGACTGCAGTGGGCTGG - Intronic
1045523665 8:102925180-102925202 ACAGTTAGACAGCAGTTGGGTGG + Intronic
1046156187 8:110293291-110293313 ACAGAGAGAGAGAAGGGGGGCGG - Intergenic
1048318210 8:133377423-133377445 ACACAGAGACTGCAGACAGGAGG + Intergenic
1048957285 8:139547555-139547577 ACAGAGATGCTGAAGTGTGGAGG - Intergenic
1049268216 8:141680863-141680885 ACACAGTGCCTGGAGTGGGGAGG - Intergenic
1049290916 8:141801431-141801453 ATAAAGAGGCTGCTGTGGGGTGG - Intergenic
1050807429 9:9698609-9698631 AGCCAGAGACTGGAGTGGGGAGG - Intronic
1051345607 9:16148092-16148114 AGAGGGAGAGTGCAGTGGGTGGG + Intergenic
1054717636 9:68572370-68572392 AGAGAGAGAGAGAAGTGGGGGGG + Intergenic
1055755690 9:79555193-79555215 GCAGAGAGATTGGAGTGTGGGGG - Intergenic
1056214332 9:84393483-84393505 ACGGGGAGGCTGCAGGGGGGCGG + Intergenic
1056459364 9:86794757-86794779 AGAGAGAGAGTGCAAGGGGGTGG + Intergenic
1057408866 9:94798651-94798673 ACAGAGAAACTGGAGTGTGCAGG - Intronic
1057431143 9:94995368-94995390 ACAGAGATAATGCTGTGGTGAGG - Intronic
1057787135 9:98095766-98095788 ACTGAGGGACAGCAGTGGTGGGG + Intronic
1058188384 9:101883422-101883444 ACAGATAGACTGGAGGAGGGAGG + Intergenic
1058321525 9:103636916-103636938 ACATAGAGTCTGGAGTGGTGAGG + Intergenic
1058382355 9:104391186-104391208 ACACAAAGACTGCAGCTGGGTGG - Intergenic
1058710391 9:107674119-107674141 ACAGCTAGACTGGCGTGGGGAGG - Intergenic
1058837246 9:108869097-108869119 ACTGAGTGACTGCAGTTAGGAGG - Exonic
1060166580 9:121422383-121422405 ACAGAGAGACTGCATTCGTTTGG - Intergenic
1060325274 9:122608596-122608618 ACAGAGAGACTACAGAGAGGTGG - Intergenic
1060789519 9:126476451-126476473 ACTGAGAGACTGCAGGGAGCGGG - Intronic
1060939873 9:127536969-127536991 ACAGAGAGGCTGGGGTGGGGTGG + Intronic
1061163749 9:128910844-128910866 ACACGGAGGCTGCAGAGGGGAGG - Intronic
1061449066 9:130659069-130659091 ACAGAGAGACTGGAGTGTGAGGG - Intergenic
1061770472 9:132916294-132916316 CCAGAGTGGTTGCAGTGGGGAGG - Intronic
1061903885 9:133686671-133686693 CCAGAGGGACAGAAGTGGGGGGG - Intronic
1062035263 9:134380062-134380084 ACAGAGGGGCTGCAGGGGAGAGG - Intronic
1203367907 Un_KI270442v1:274335-274357 ATGGAGAGACTGCAGTGGGTAGG - Intergenic
1185527978 X:794325-794347 AGGCAGAGACTGCAGTGAGGCGG + Intergenic
1185586668 X:1246316-1246338 AGGCAGAGACTGCAGTGAGGTGG + Intergenic
1185586730 X:1246653-1246675 TGACAGAGACTGCAGTGAGGCGG + Intergenic
1185637185 X:1561376-1561398 ACAGAGAGACGGAGGTAGGGAGG - Intergenic
1185714443 X:2330061-2330083 GCAGAGAGACGGCGGGGGGGGGG + Intronic
1185852322 X:3500739-3500761 AGAGAGAGACTGTAGTGAGGAGG + Intergenic
1186515768 X:10165236-10165258 ACAGAGAGCCTGCTGTTGGCTGG + Intronic
1187467674 X:19541395-19541417 ACCATGAGACTGCAGTGGGCGGG - Intronic
1187945820 X:24425552-24425574 AGAGAGAGAGTGAAGTGGAGAGG + Intergenic
1189382052 X:40508992-40509014 GGAGAGAGACTGCAGTGGCCTGG - Intergenic
1189812566 X:44794290-44794312 AGAGAGAGAGAGAAGTGGGGTGG - Intergenic
1189881397 X:45497392-45497414 ACAGAGAGACTCCATTTTGGAGG - Intergenic
1190028956 X:46953225-46953247 TCAGAGAAACTGGAGTGGTGAGG - Intronic
1190480564 X:50872669-50872691 CGAGAGAGAGAGCAGTGGGGAGG - Intergenic
1190916687 X:54816472-54816494 AGAGAGAGACTTGAGTAGGGAGG + Intergenic
1191663208 X:63671417-63671439 ACAGTGAGACTACCTTGGGGAGG - Intronic
1192147259 X:68689899-68689921 ACAGAGGGAATACAGTGGTGGGG - Intronic
1192268400 X:69556086-69556108 GCAATGAGACTGGAGTGGGGTGG + Intergenic
1193765220 X:85520200-85520222 GCAGAGAGACTGAAGTGAGGGGG + Intergenic
1198964520 X:142214029-142214051 ACAGAGAGACTTCATTTGGTCGG - Intergenic
1201920208 Y:19225957-19225979 AGAGAGAGAAGGCAGTGAGGTGG - Intergenic