ID: 1104085175

View in Genome Browser
Species Human (GRCh38)
Location 12:125467723-125467745
Sequence CTGGATATAGGTGTTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104085175 Original CRISPR CTGGATATAGGTGTTTTTAC AGG (reversed) Intronic
902218517 1:14949936-14949958 CTGGCTAAAGGTGTGTTTACAGG + Intronic
905026070 1:34850590-34850612 CTAGATAAAGGAGGTTTTACTGG + Intronic
908070838 1:60457895-60457917 CAGCATATATGTGTCTTTACAGG - Intergenic
908412738 1:63883506-63883528 CAGGTTATAGGTATTTTTATTGG - Intronic
911869530 1:103077650-103077672 TTGGATAAAGCTGTTTTTAGAGG + Intronic
915428877 1:155849923-155849945 TGGAATTTAGGTGTTTTTACTGG - Intronic
916755730 1:167768488-167768510 CTGAATATGGGTGTTTTAAGAGG + Intronic
917109607 1:171532576-171532598 CTGGAGATGGTTGTTTTTCCAGG - Exonic
917484583 1:175444122-175444144 CTGGTTATAAGTATTTTGACTGG - Intronic
918313749 1:183305548-183305570 CAGGAGATAGCTGTTTTTCCTGG + Intronic
918583220 1:186157001-186157023 CTGGGTATCTGTGTTTTTAATGG - Intronic
922687667 1:227657615-227657637 ATGTATGTATGTGTTTTTACAGG - Exonic
923682788 1:236132404-236132426 CTGGCTAGAGTTGTTTTTTCTGG + Intergenic
1064859103 10:19806387-19806409 ATGTATGTAGTTGTTTTTACTGG - Intergenic
1066028535 10:31391838-31391860 TTGTATATATGTGTTTTTACTGG + Intronic
1068319183 10:55388499-55388521 CTGGATGGAGGTATTTTTATAGG + Intronic
1074239073 10:111618921-111618943 CTAGCTGTAGGTGTTTTTCCTGG - Intergenic
1074340334 10:112622254-112622276 CAGAATATAGTTGTTTTTGCAGG + Intronic
1082282068 11:50280714-50280736 CTGGTTATAGATATTTTCACTGG + Intergenic
1087348949 11:97006613-97006635 ATGGATATAGGTGATTCCACTGG - Intergenic
1087867523 11:103249438-103249460 CTTGATCTGGGTGTTTATACAGG - Intronic
1088159498 11:106852910-106852932 CTGGATATAGGAGTTTTGGCTGG + Intronic
1093514862 12:19973658-19973680 TTGTATATGGGTGTTTTTTCTGG + Intergenic
1093697796 12:22182038-22182060 CTAGATATAGTTTTTTTTTCTGG - Intronic
1097051335 12:56224926-56224948 CTGGAGACAGGTGTCTATACTGG + Exonic
1098480713 12:70956563-70956585 CAGTCTATAGGTGTCTTTACAGG - Intergenic
1099121542 12:78695711-78695733 CTGGAGATAGGTGTGTTTTGGGG - Intergenic
1103644211 12:122377930-122377952 CTGGATATGGTTTTTTCTACTGG + Exonic
1104085175 12:125467723-125467745 CTGGATATAGGTGTTTTTACAGG - Intronic
1104422271 12:128645864-128645886 CTGGATGTGAGTGTGTTTACTGG + Intronic
1104422273 12:128645899-128645921 CTGGATGTGAGTGTGTTTACTGG + Intronic
1104422276 12:128645934-128645956 CTGGATGTGAGTGTGTTTACTGG + Intronic
1104422296 12:128646171-128646193 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422322 12:128646486-128646508 CTGGATGTGAGTGTGTTTACTGG + Intronic
1104422325 12:128646521-128646543 CTGGATGTGAGTGTGTTTACTGG + Intronic
1104422328 12:128646556-128646578 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422410 12:128647508-128647530 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422470 12:128648239-128648261 TTGGATGTGGGTGTGTTTACTGG + Intronic
1104422473 12:128648274-128648296 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422488 12:128648447-128648469 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422491 12:128648482-128648504 TTGGATATGAGTGTGTTTACTGG + Intronic
1104422526 12:128648890-128648912 TTGGATATGGGTGTGTTTACTGG + Intronic
1109054041 13:57524505-57524527 CTGCATATAAGTCTTTTTGCAGG - Intergenic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1110872969 13:80474232-80474254 CTGTATATAGTTCTCTTTACTGG + Intergenic
1110974402 13:81810928-81810950 CAGTATATATGTGTTTTTATAGG - Intergenic
1111164163 13:84435959-84435981 ATGTATATATGTGTATTTACTGG + Intergenic
1113715040 13:112498055-112498077 TTGCATATATGTGTGTTTACAGG - Intronic
1116458966 14:45148973-45148995 CTGGATATAGGTCTTTTGGATGG - Exonic
1117387470 14:55230487-55230509 ATGGATATAGGATTTTTTCCTGG + Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1120216303 14:81683806-81683828 CTGGATACATGTGTTTCTTCTGG - Intergenic
1121961180 14:98261710-98261732 CTAGATGTAGGTTTTTTTCCTGG - Intergenic
1122191712 14:100050128-100050150 CTGGAAAAAAATGTTTTTACGGG - Intronic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1125161475 15:36649408-36649430 CTGTATAAAGTTGTTTTAACTGG - Intronic
1126549523 15:49911285-49911307 CAGTCTATAGGTGTCTTTACAGG - Intronic
1127025147 15:54796890-54796912 CTGGGCATTGGTGTTTTAACAGG - Intergenic
1131191214 15:90318367-90318389 ATGGATAGAGGTATTTTAACTGG - Intergenic
1140918226 16:79512804-79512826 ATGGATGTAGGTGTGTTTCCAGG + Intergenic
1144069750 17:11659107-11659129 CTGGATATGGATGTTTCTTCTGG + Intronic
1145757930 17:27406366-27406388 CTGGGGATAGGTGTTCTAACAGG + Intergenic
1157060204 18:44279167-44279189 TTGGACAGAGGTGATTTTACAGG + Intergenic
1158093852 18:53747585-53747607 CAGGATATTGGTGTCTTTCCTGG - Intergenic
1159111733 18:64067419-64067441 CTGTCTATATGTGTCTTTACAGG + Intergenic
925596682 2:5562417-5562439 CTGGATATAATTGTTTTTCATGG - Intergenic
926770632 2:16371094-16371116 CTGGTTATTGTTGTTTTTAATGG + Intergenic
930267487 2:49216903-49216925 GTGGATATAGCTGCTTTTAAAGG + Intergenic
931045199 2:58343475-58343497 CTGTCTATATGTGTCTTTACAGG - Intergenic
931224255 2:60316197-60316219 CTGGGTCTAGGTATTGTTACAGG - Intergenic
933772894 2:85755031-85755053 CGGGATAGAGGTGTGTTTAAGGG + Intronic
934324434 2:91999339-91999361 TTGGTTTTAGGTGTTTTTCCTGG + Intergenic
935236825 2:101145805-101145827 CAGGAGAAAGGTGTTTTTATAGG - Intronic
939039777 2:137174197-137174219 CTGCATATAGGTGTTTAGAAAGG + Intronic
940518274 2:154709651-154709673 CTGGATGTAGGTTTTAGTACAGG + Exonic
941544444 2:166830817-166830839 TTGGATAGAGGTTTTTTGACAGG + Intergenic
941832334 2:169976047-169976069 CAGTTTATATGTGTTTTTACTGG + Intronic
944383372 2:199137647-199137669 CTTGGTATAGGTGATTTTCCAGG - Intergenic
1169557272 20:6764693-6764715 CTGGATGAAGTTTTTTTTACAGG - Intergenic
1171048047 20:21829545-21829567 CTGGATCTAGATGTTATTCCCGG + Intergenic
1172127163 20:32631466-32631488 CTAGGTATAGGTGTTGGTACAGG + Intergenic
1180516646 22:16150625-16150647 CTGGATCTAAGACTTTTTACAGG - Intergenic
1182959526 22:34458913-34458935 CTGGATATAAGTGATTTTGCTGG + Intergenic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
950179262 3:10899711-10899733 ATGGAGATAAGTGTTTTTAGTGG - Intronic
952976316 3:38699251-38699273 CTGGAGATAGGTTTTTTTGGGGG + Intronic
955487130 3:59446664-59446686 CTGGAAATAGATGTTTTTAAAGG + Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
958774942 3:98470944-98470966 ATGGATGTAAGTGATTTTACTGG - Intergenic
959647423 3:108719337-108719359 CTGGTCATAGTTGATTTTACTGG - Intergenic
960213660 3:115003048-115003070 CGGGATATAGCTGTTTAGACTGG - Intronic
964263654 3:154869877-154869899 ATGGATATAGGTATTGATACAGG - Intergenic
964579408 3:158215649-158215671 CTGTATATAGATTTTTTTAGTGG + Intronic
965290153 3:166868059-166868081 CTGCTTTTAGATGTTTTTACAGG + Intergenic
966360603 3:179125375-179125397 CAGGCTATATGTGTTTTTACAGG - Intergenic
967390900 3:188953193-188953215 CTGGATTATGGTGTTTTTATAGG - Intronic
967818068 3:193815658-193815680 CTGGCTAGTGGTGTTTTGACAGG + Intergenic
969328038 4:6455250-6455272 AGGGCTATAGGTGTTTTTAAGGG - Intronic
973021849 4:45213028-45213050 CTAGATATATGTGTTATTGCAGG - Intergenic
973624406 4:52757016-52757038 CAGGATCCAGGTGTTCTTACAGG - Intergenic
976672271 4:87666556-87666578 CTGGATAAAGGGGTTATAACAGG - Intergenic
976690180 4:87860446-87860468 CTGGATACAGATCTTTTTTCTGG + Intergenic
977445535 4:97127058-97127080 GTGTATAGAGGTGTTTTTAATGG - Intergenic
978542820 4:109837164-109837186 CTGGCTATGGCTGCTTTTACAGG - Intronic
980256681 4:130389712-130389734 CTTGATATAAATGTTTTTGCAGG - Intergenic
984379103 4:178967636-178967658 CTGAATAAAGTTGTTTCTACGGG + Intergenic
985162393 4:187058151-187058173 TTGGATATAGCTGTGTTTAACGG - Intergenic
987964341 5:24852521-24852543 CTGAATATAGGGGTGTTAACTGG - Intergenic
988263272 5:28918607-28918629 CTAAATATAGGTGTTACTACTGG + Intergenic
988423844 5:31039605-31039627 CTGGATATTGGTCCTTTGACAGG - Intergenic
993951327 5:94179412-94179434 CTGGAAAGAAGTGTTTTGACTGG + Intronic
994782960 5:104116358-104116380 CTGGACATGGGTATTTTTATAGG + Intergenic
1003295925 6:4828210-4828232 CTGGATATAGGACTTTTAACAGG + Intronic
1004411618 6:15386347-15386369 CTGGAGATATGTGGTTTCACAGG - Intronic
1005098881 6:22147626-22147648 CTGAATACAGCTGTGTTTACAGG - Intergenic
1005652004 6:27893291-27893313 CTGAATATACGTGTTTTGATTGG + Intergenic
1006969427 6:38026170-38026192 CTGGATGTAAGTGTATTTAGGGG - Intronic
1010688659 6:78881661-78881683 CTGGAAAATGGTGTTTTGACTGG + Intronic
1011661713 6:89600473-89600495 CTGGAAAAAGTTGTTTTTATTGG + Intronic
1012347462 6:98208249-98208271 CTGAATATTGGTTTTTTAACTGG - Intergenic
1023542791 7:41284067-41284089 ATGAATATAAGGGTTTTTACAGG - Intergenic
1026298275 7:69075138-69075160 CTGGATTTATGTCTTTTTATAGG + Intergenic
1026306352 7:69145431-69145453 CTGGATATGAGTGTTTCTATGGG + Intergenic
1028572335 7:92304585-92304607 CTAGATAAATGTGTTTGTACAGG + Intronic
1031205591 7:118753250-118753272 CAGGTTATAGGAGATTTTACAGG + Intergenic
1031371704 7:120975937-120975959 ATGGTTATGGGTGTTTTGACTGG + Exonic
1031821935 7:126512844-126512866 CTGGAAATAGGTGCTGTTACTGG + Intronic
1036595070 8:10204713-10204735 CTGTATATATGTATTTTTAATGG + Intronic
1037131976 8:15417509-15417531 CTGGACATCTGTGGTTTTACAGG - Intronic
1037918050 8:22784731-22784753 TTGGATTTAGGGGTTTTTCCTGG - Intronic
1041672581 8:60507288-60507310 TTGGATATAAGAGTTTTCACAGG + Intergenic
1044210755 8:89547527-89547549 CTGCATATAGGTGTATTTGTGGG - Intergenic
1044332359 8:90936095-90936117 CTGAATATAGGAGGTTTTACAGG - Intronic
1044411440 8:91888222-91888244 CTTGACAAAGGTGATTTTACTGG + Intergenic
1045596382 8:103660659-103660681 CTGGACATAGATGTGTTTCCAGG + Intronic
1048100379 8:131344235-131344257 ATGGAAATAGGGGTTTTTATGGG - Intergenic
1050158349 9:2691850-2691872 CTGGAGTTTGGTGATTTTACTGG - Intergenic
1050285265 9:4095255-4095277 CTGGACATAAATGTTTTAACCGG + Intronic
1054849208 9:69829202-69829224 CTGGATATAGTAGTTTTTTGGGG + Intronic
1058326227 9:103701250-103701272 CTGGATTTTGTTGTATTTACTGG - Intergenic
1187060410 X:15781610-15781632 CTGCATGTAGGTGTCTTAACTGG - Intronic
1189347864 X:40255933-40255955 CCGTATATACGGGTTTTTACAGG + Intergenic
1189460354 X:41237639-41237661 CTGGAAATAGGTTTTTGTAGTGG + Intergenic
1189906809 X:45769791-45769813 CTGGATAAAGGAGTATTTCCTGG + Intergenic
1194079962 X:89449307-89449329 CTGGACATAGGGGTTTTAAAGGG + Intergenic
1195851654 X:109288848-109288870 CTGGATATAAGCAATTTTACTGG + Intergenic
1196719672 X:118841454-118841476 CTGTATATAGTTGCTTTTTCTGG + Intergenic
1200432584 Y:3104581-3104603 CTGGACATAGGGGTTTTAAAGGG + Intergenic