ID: 1104093462

View in Genome Browser
Species Human (GRCh38)
Location 12:125535387-125535409
Sequence AAATCTCAGCAGCATTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104093462_1104093466 20 Left 1104093462 12:125535387-125535409 CCTGTGAAATGCTGCTGAGATTT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 1104093466 12:125535430-125535452 TTCCTCCCATACCTTGACCAAGG 0: 1
1: 1
2: 2
3: 10
4: 167
1104093462_1104093467 21 Left 1104093462 12:125535387-125535409 CCTGTGAAATGCTGCTGAGATTT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 1104093467 12:125535431-125535453 TCCTCCCATACCTTGACCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104093462 Original CRISPR AAATCTCAGCAGCATTTCAC AGG (reversed) Intronic