ID: 1104093729

View in Genome Browser
Species Human (GRCh38)
Location 12:125537488-125537510
Sequence TCCGCCCCAGGTGACTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104093729_1104093739 28 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093739 12:125537539-125537561 GGGGCATCACTGGGAGAGGAAGG 0: 1
1: 0
2: 1
3: 34
4: 367
1104093729_1104093735 9 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093735 12:125537520-125537542 TTGACAATGGCTGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 301
1104093729_1104093731 -4 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093731 12:125537507-125537529 CGGACATCCATTCTTGACAATGG 0: 1
1: 0
2: 0
3: 2
4: 34
1104093729_1104093736 18 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093736 12:125537529-125537551 GCTGCAGTGAGGGGCATCACTGG 0: 1
1: 0
2: 4
3: 22
4: 214
1104093729_1104093737 19 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093737 12:125537530-125537552 CTGCAGTGAGGGGCATCACTGGG 0: 1
1: 0
2: 2
3: 15
4: 186
1104093729_1104093734 8 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093734 12:125537519-125537541 CTTGACAATGGCTGCAGTGAGGG 0: 1
1: 0
2: 3
3: 19
4: 197
1104093729_1104093733 7 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093733 12:125537518-125537540 TCTTGACAATGGCTGCAGTGAGG 0: 1
1: 1
2: 2
3: 21
4: 189
1104093729_1104093738 24 Left 1104093729 12:125537488-125537510 CCTTCTAAGTCACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1104093738 12:125537535-125537557 GTGAGGGGCATCACTGGGAGAGG 0: 1
1: 0
2: 0
3: 34
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104093729 Original CRISPR TCCGCCCCAGGTGACTTAGA AGG (reversed) Intronic
904358945 1:29960113-29960135 TCTGCCCCAGAAGACCTAGAGGG + Intergenic
906678268 1:47708723-47708745 TCAGCCCCAGGGGCCTTAGGCGG - Intergenic
915630496 1:157150571-157150593 TCTGCCCCAGGTATCTTGGAGGG + Intergenic
916517307 1:165531738-165531760 TCTGACACAGGTGACTGAGATGG - Intergenic
1067355392 10:45519908-45519930 TCTAGCCCAGGTGACTCAGAGGG + Intronic
1067702254 10:48582329-48582351 TCTGGCCCAGGTGTCTTGGATGG + Intronic
1070481945 10:76891269-76891291 TGGGCCTCAGTTGACTTAGAAGG + Intronic
1081864622 11:46352674-46352696 GCCCCCGCAGCTGACTTAGAGGG - Intronic
1082806763 11:57456788-57456810 GCCATCCCTGGTGACTTAGAAGG - Intergenic
1083678683 11:64341589-64341611 TGCGCCCCAGGTGACCCAGCCGG + Exonic
1084591269 11:70092049-70092071 TCCTCCCCTGGAGTCTTAGAGGG - Intronic
1087756714 11:102062292-102062314 GCAGCCCAAGGTGACTAAGATGG + Intronic
1088767933 11:113002722-113002744 TCTGCCACAGGAGACTTAGCTGG - Intronic
1103945870 12:124526235-124526257 TCCACCCCAGGTGACAGTGAGGG + Intronic
1104093729 12:125537488-125537510 TCCGCCCCAGGTGACTTAGAAGG - Intronic
1120281780 14:82447830-82447852 TCCTCCCCAGCTGGCTTAGCTGG - Intergenic
1121970905 14:98354942-98354964 TCTGCCCCAGGGGAATTAAACGG + Intergenic
1122597987 14:102906891-102906913 TACGGCCCACGTGCCTTAGATGG + Exonic
1124635370 15:31361543-31361565 TCCCCCCCAGGAGACACAGAAGG + Intronic
1124985238 15:34603212-34603234 TCAGCCACAGTTGACGTAGACGG + Intergenic
1128405722 15:67335743-67335765 TTCTCCCCAGGTGAGTCAGAAGG - Intronic
1130867163 15:87942906-87942928 TCCGCACCTGGTGACTGAGCTGG + Intronic
1131395730 15:92084543-92084565 TCCACCCCAGGAGACCTTGAGGG + Intronic
1136264127 16:29104792-29104814 TCCACCTCATGTGACTTGGAGGG - Intergenic
1149635655 17:58167003-58167025 TTCGCCCTATGAGACTTAGAGGG + Intergenic
1160050575 18:75429636-75429658 TCAGCCCCAGTTGATTCAGAGGG - Intergenic
1168531768 19:57135772-57135794 GCCTCCTCAGGTGACTTTGAAGG + Exonic
925738363 2:6983811-6983833 TCCTCCCCAGATGTCTCAGATGG + Intronic
932683487 2:73847690-73847712 TCCACCACAGGTGGCTTAGCTGG - Exonic
933723694 2:85414058-85414080 GCCGCCCCCGGTGAGTCAGAGGG + Intronic
943838465 2:192546419-192546441 TCCGCCCCAGAAGACTTACATGG - Intergenic
945580420 2:211587543-211587565 TCCTCCCCTAGAGACTTAGAGGG + Intronic
946870256 2:224078525-224078547 TCCGCCCCATGTCACATAGATGG + Intergenic
1171977855 20:31606765-31606787 ACCTCCCCAGGTGATCTAGATGG - Intergenic
1173606710 20:44336950-44336972 TCCACCCCAGGGGACTGAGTGGG - Intergenic
1179465159 21:41567164-41567186 TCCCACCCAGGTGACTGAGGAGG - Intergenic
1183199287 22:36374809-36374831 CCAGCCCCAGGTGACTCACAGGG + Intronic
1184891908 22:47385004-47385026 GCAGCCCCAGGGGACTAAGAAGG + Intergenic
953708545 3:45249784-45249806 TCTGCCTCATGTGACTCAGAAGG + Intergenic
961009612 3:123426983-123427005 TCTTCCCCAGGGGACTTGGATGG - Intronic
968642639 4:1722041-1722063 TCCGCCGCAGGCGGCCTAGATGG - Intronic
969629928 4:8330110-8330132 TCCTGCCCAGGGGACTGAGAGGG + Intergenic
982621307 4:157709437-157709459 TCTGCTCCAGGTAACATAGATGG + Intergenic
995240728 5:109883175-109883197 TCTGGTCCAGGTTACTTAGACGG - Exonic
997425785 5:133801704-133801726 TCAGCCCCAGATAACTTGGAGGG - Intergenic
1006906207 6:37535524-37535546 TCTGCTCCTGGTGACCTAGAAGG - Intergenic
1009434059 6:63598179-63598201 TCTGACCTAGGAGACTTAGAGGG + Intergenic
1016682986 6:146852002-146852024 GCCGCCCAAGCTGACTAAGATGG - Intergenic
1019488620 7:1300822-1300844 ACCGCCCCAGCTGACCTGGATGG - Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1037617677 8:20534144-20534166 TCAGCCACCGGTGACTCAGAAGG - Intergenic
1045180015 8:99770709-99770731 TACCCACAAGGTGACTTAGAAGG - Intronic
1057953264 9:99386584-99386606 TCAGCCCAAGGTGACTGAGAAGG + Intergenic
1060724500 9:125998001-125998023 TCATCCCCAGGAGACTTAGGGGG + Intergenic
1062053004 9:134457093-134457115 TCCACCCCACGGGACATAGAGGG - Intergenic
1186932171 X:14405815-14405837 TCAGCCCCAGCTGAATCAGATGG + Intergenic
1195338148 X:103877600-103877622 TCCACCCTAGGTCACTCAGAAGG - Intergenic
1200771509 Y:7129789-7129811 TCAGTCCCAGGTGACTTACCTGG - Intergenic