ID: 1104094155

View in Genome Browser
Species Human (GRCh38)
Location 12:125541287-125541309
Sequence CTTGAGTTTCAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104094152_1104094155 8 Left 1104094152 12:125541256-125541278 CCTCAACAAATATTTGTTATTGA 0: 1
1: 0
2: 6
3: 51
4: 479
Right 1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104094155 Original CRISPR CTTGAGTTTCAGAAGGAGCC AGG Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900817451 1:4859359-4859381 CATGAGATTGAGGAGGAGCCAGG + Intergenic
904529468 1:31158775-31158797 CAGGAGTTTAAGAAGCAGCCTGG + Intergenic
907067519 1:51500772-51500794 CAGGAGTTTCAGAACCAGCCTGG + Intronic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909368802 1:74860438-74860460 CATGAGATTTAGAAGGGGCCAGG - Intergenic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
920915923 1:210257930-210257952 CTGCAGCTTGAGAAGGAGCCAGG - Intergenic
921105164 1:211969669-211969691 CCTGAGTTTCCCAAGTAGCCGGG + Intronic
921374604 1:214460850-214460872 CATGGCTTTCAGAAGGATCCAGG - Intronic
922228711 1:223667427-223667449 CTTGAGTTTCTGATGAAACCTGG - Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065359016 10:24871686-24871708 CTTCCTTTTCAGAAGGTGCCTGG + Intronic
1065999785 10:31093417-31093439 CTTGAGTTACAGGAGGAAACAGG - Intergenic
1066617820 10:37313653-37313675 CTTAAGTCTCACCAGGAGCCAGG - Intronic
1067138132 10:43629781-43629803 CTACAGTTTCAGAGGGAGCACGG + Intergenic
1067922872 10:50477551-50477573 CATGAGATTCGGGAGGAGCCAGG + Intronic
1068808245 10:61224927-61224949 CTTGTGTTTCAGCAGGAGGGAGG + Intergenic
1069246025 10:66207748-66207770 TTTGAGTTTCAGAAGGACTAGGG + Intronic
1071981858 10:91011425-91011447 CATGAATTTCAGAAGGAGAGTGG + Intergenic
1074005371 10:109417379-109417401 CTTGACTCTCAGGAGTAGCCAGG + Intergenic
1074750867 10:116585902-116585924 GTAGAGTTCCAGAAGGAGCATGG - Intergenic
1075876511 10:125810685-125810707 CTAGAATCTCAGCAGGAGCCTGG - Intronic
1076097525 10:127744209-127744231 CTGGATTGTCAGAAGGAGTCTGG - Intergenic
1078483693 11:11702848-11702870 GTTGAGTTTTAGAAGCATCCAGG + Intergenic
1078491441 11:11772874-11772896 CTTGTCTCTCAGAAGCAGCCAGG + Intergenic
1079417586 11:20253973-20253995 GTTGAGTTTCAGACTGTGCCTGG - Intergenic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1080257152 11:30303354-30303376 CTTGGGTTTTACAAGGACCCTGG - Intergenic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081081786 11:38750659-38750681 CTTAAGTTCCAGAAGAAGGCAGG - Intergenic
1081136819 11:39449615-39449637 CATGAGTCTCAGAAGGGGCCAGG - Intergenic
1081185442 11:40036792-40036814 CTTGTGTTGAAGGAGGAGCCTGG - Intergenic
1083313774 11:61801621-61801643 CTCCAGTTTCAGAAGCAGGCAGG - Exonic
1084836848 11:71808180-71808202 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1087216684 11:95502533-95502555 TTTGAGTTACAGAAGGTGCCAGG + Intergenic
1089768330 11:120784743-120784765 CTTGAGTTTCAGAGTCTGCCAGG + Intronic
1091121730 11:133063308-133063330 GTTGGGTTTAAGAAGGAGACAGG - Intronic
1091180453 11:133599764-133599786 CTTGTGTTTCTGATGGGGCCTGG - Intergenic
1092205432 12:6611979-6612001 CTTGAGTTCCAGAAAGGGCTCGG + Intergenic
1092402386 12:8187924-8187946 CTTGACTCTCAGAAGGACCAAGG - Intronic
1093551691 12:20420190-20420212 CTTGGGTATCACATGGAGCCAGG + Intronic
1097735522 12:63177202-63177224 CATGAGATTCAGGAGGGGCCAGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1098205938 12:68109736-68109758 ATTGGGTTCCAGAAGGAGCTGGG - Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099176528 12:79428986-79429008 TTTGAGTTTTAAAAAGAGCCTGG - Intronic
1100068878 12:90685867-90685889 CTTAAATTTCAGAATCAGCCAGG - Intergenic
1100086147 12:90913366-90913388 CATGAGATTTAGGAGGAGCCAGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1100634328 12:96420730-96420752 CTTGAGTGTCTGAAAGAGCCAGG + Intergenic
1100897522 12:99200849-99200871 CTTGACTGTATGAAGGAGCCAGG + Intronic
1102965580 12:117123007-117123029 CCTCAGTTTCAGGAGTAGCCGGG - Intergenic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1105309254 13:19191661-19191683 CTGGAATTTGAGAAGGAGCAGGG + Intergenic
1108675602 13:52735296-52735318 GATGACTGTCAGAAGGAGCCTGG + Intronic
1108971301 13:56380522-56380544 CATGAGATTTAGAAGGAGGCAGG - Intergenic
1109304990 13:60628560-60628582 TTTAAGTTACAGAAGGAGCTCGG - Intergenic
1111718890 13:91916965-91916987 CTTGAGATTTGGAAGAAGCCAGG - Intronic
1112464331 13:99630166-99630188 CTTCTGTTTCAGAAGCAGCTTGG + Intronic
1112824952 13:103381673-103381695 CATGAGATTCAGGAGGGGCCAGG - Intergenic
1113132991 13:107059417-107059439 CATGAGATTTGGAAGGAGCCAGG - Intergenic
1113159044 13:107358369-107358391 CTTGAGCTTCAGTGGGATCCAGG + Intronic
1115038846 14:28895472-28895494 CTTGATTTTCTGAAGTAGCATGG + Intergenic
1115773522 14:36690465-36690487 CTTGGGAGTCAGAAGGAGCTGGG - Intronic
1115930713 14:38490000-38490022 CTTCAGTTTCAGCAATAGCCTGG + Intergenic
1116621742 14:47212933-47212955 ATTGAGCTTCAGAAGCAACCGGG - Intronic
1117752132 14:58935343-58935365 CATGAGATTCGGAAGGGGCCAGG - Intergenic
1118182689 14:63508874-63508896 CTTAAGGTCCAGAAGAAGCCAGG + Intronic
1118325419 14:64777295-64777317 GCTGAGTTTCAGAAGCAGGCAGG + Intronic
1118402711 14:65394449-65394471 CATGAGATTTGGAAGGAGCCAGG - Intergenic
1118839350 14:69499560-69499582 CCTGAGTCCCAGAAGGAGACTGG + Intronic
1119995750 14:79251932-79251954 CTTGAGCTTCACAAGTAGCTGGG + Intronic
1120645723 14:87071692-87071714 GCTGAGTTTCAAATGGAGCCTGG - Intergenic
1121512642 14:94523656-94523678 CCAGAGTCTCAGAAGGAGCGTGG - Intergenic
1122801870 14:104235032-104235054 CATGAGTTTTGGAAGGGGCCAGG + Intergenic
1123147886 14:106151441-106151463 CATGAGATTTAGGAGGAGCCAGG + Intergenic
1202893887 14_KI270722v1_random:184572-184594 CTTGAGTTTCCCAAGTAGCTGGG - Intergenic
1123437682 15:20267370-20267392 CTTCAGTTTCACAAGTAGCTGGG - Intergenic
1123677988 15:22731560-22731582 CTTAAGTTTGAGGAGGTGCCAGG - Intergenic
1123737446 15:23199439-23199461 CATGAGATTCAGGAGGCGCCAGG - Intergenic
1124170791 15:27370948-27370970 CTTCAGTTTGAGAAGGAGCAGGG - Intronic
1124288660 15:28428102-28428124 CATGAGATTCAGGAGGCGCCAGG - Intergenic
1124330188 15:28805831-28805853 CTTAAGTTTGAGGAGGTGCCAGG - Intergenic
1124662042 15:31557798-31557820 CTAGAGTTCCAGAAGAAGACAGG - Intronic
1126716483 15:51523741-51523763 CTTGAATATCAGAAAGAGCATGG + Intronic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128814101 15:70593053-70593075 CTTGAGATTTAGGAGAAGCCAGG + Intergenic
1129779215 15:78258984-78259006 CTGGAGGTTGAGAAGGAGCCAGG - Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1134004590 16:10809764-10809786 CTTGGGATGCAGGAGGAGCCTGG - Intronic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1136690863 16:32027993-32028015 CATGAGATTTAGGAGGAGCCAGG - Intergenic
1136710068 16:32229596-32229618 CATGAGATTCAGGAGGTGCCAGG + Intergenic
1136757841 16:32699815-32699837 CATGAGATTCAGGAGGTGCCAGG - Intergenic
1136791452 16:32971555-32971577 CATGAGATTTAGGAGGAGCCAGG - Intergenic
1136810265 16:33170560-33170582 CATGAGATTCAGGAGGTGCCAGG + Intergenic
1136816741 16:33280640-33280662 CATGAGATTCAGGAGGTGCCAGG + Intronic
1136846894 16:33583485-33583507 CTTCAGTTTCACAAGTAGCTGGG + Intergenic
1136878362 16:33882377-33882399 CATGAGATTTAGGAGGAGCCAGG + Intergenic
1137314291 16:47299981-47300003 CTTGTGTTTCAGAAAGGGCATGG + Intronic
1137631369 16:49948126-49948148 CATGGGTTTCAGATGGAGCATGG + Intergenic
1139747037 16:69083054-69083076 CTTGGGTTGGAGAAGGAGGCAGG - Intronic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1203059991 16_KI270728v1_random:960164-960186 CATGAGATTCAGGAGGTGCCAGG - Intergenic
1203093661 16_KI270728v1_random:1233016-1233038 CATGAGATTTAGGAGGAGCCAGG - Intergenic
1203108602 16_KI270728v1_random:1432140-1432162 CTTCAGTTTCACAAGTAGCTGGG + Intergenic
1145932732 17:28697678-28697700 CTTGTGATTCAGAAGGTCCCGGG - Exonic
1146081224 17:29782478-29782500 CATGACTTCCAGAAGGAGTCTGG - Intronic
1146253051 17:31367105-31367127 CTTGGTTTTCAGAAGGAATCTGG - Intronic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1148163813 17:45468412-45468434 CTTGAGTTCCAGAGGCTGCCTGG + Exonic
1148668868 17:49395231-49395253 CTTCAGTCTCAGACTGAGCCAGG - Intronic
1149914681 17:60598319-60598341 CTTGAGTTTCTGAGGGAGGAAGG + Intergenic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150395043 17:64815066-64815088 CTTGAGTTCCAGAGGCTGCCTGG + Intergenic
1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG + Intergenic
1151900021 17:77006125-77006147 TATGACTTTCAGAAGCAGCCTGG + Intergenic
1151985822 17:77542840-77542862 CTTAAGTATCTGAAGGACCCGGG + Intergenic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1155502348 18:26499760-26499782 CTTGAGCTTCAGAAGGGCACCGG - Intronic
1155664320 18:28290002-28290024 CTTGAATATCAGCAGGATCCAGG + Intergenic
1156157281 18:34318060-34318082 TTTTAGTTTGATAAGGAGCCTGG - Intergenic
1157034421 18:43953878-43953900 CATGAGCTTCAGGAGGGGCCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158437598 18:57444406-57444428 CTTGAGTTCCAGCAGGATCTGGG + Intronic
1160077341 18:75691130-75691152 CTTGATGTTCAGAGTGAGCCTGG - Intergenic
1161374543 19:3932834-3932856 TTTTAATTTCAGATGGAGCCGGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1166740156 19:45109690-45109712 CTCAAGTTTCAGCAGGAGCCTGG + Intronic
1167592867 19:50413865-50413887 CTGGAGTTTGAGAAGGTGCGTGG + Exonic
1168583004 19:57570805-57570827 GTAGAGAATCAGAAGGAGCCTGG - Intergenic
925620916 2:5791775-5791797 TCTGTGTTTCAGGAGGAGCCTGG + Intergenic
925718950 2:6809968-6809990 CATGGGTTTGAGAAGGAGCATGG - Intergenic
926123581 2:10257741-10257763 TCTGAGTTTCAGGAGGAGCAGGG - Intergenic
926351888 2:12003195-12003217 CTTGTGTTCCATAAGGACCCTGG + Intergenic
926572583 2:14545556-14545578 CTTGAATTTCAGAAGGGCCTAGG - Intergenic
927577462 2:24211246-24211268 CTTAAATTTCGGAAGGAGTCGGG - Intronic
928835638 2:35541340-35541362 CTTCAGTTTCCCAAAGAGCCGGG + Intergenic
929612949 2:43285203-43285225 CATGAGATTCAGGAGGGGCCTGG + Intronic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
931671113 2:64648707-64648729 CTGGAGCTTTAGAAGGAGGCAGG + Intronic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
934579570 2:95427491-95427513 CCTCAGTATCAGAACGAGCCAGG - Intergenic
934599874 2:95649234-95649256 CCTCAGTATCAGAACGAGCCAGG + Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
936341059 2:111633159-111633181 TTTGGGTTTCAGAAAGACCCGGG - Intergenic
936533219 2:113291238-113291260 CCTCAGTATCAGAACGAGCCAGG + Intergenic
936655648 2:114483673-114483695 CTTGAATTTCATTAGAAGCCAGG + Intronic
936788852 2:116126066-116126088 GTTGACTTTTAGAAGCAGCCAGG + Intergenic
937783650 2:125869631-125869653 CCTTTGTTTCAGAAGGAGCATGG + Intergenic
940259064 2:151761621-151761643 CCCAAGTTTCAGAAGGAGCCTGG + Intergenic
941261913 2:163307681-163307703 CATGAGATTCAGGAGGGGCCAGG + Intergenic
941569460 2:167152090-167152112 CTTGTGTTTCAGATGGATTCAGG + Intronic
942302412 2:174574547-174574569 CTTGAGTTTCTGTAGTAGCTGGG + Intronic
942707035 2:178785889-178785911 TATGAGTCTCAGAAGGAGCCTGG + Exonic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
944948546 2:204718858-204718880 TTTCAGTTTCTGAAGGAACCAGG - Intronic
947960637 2:234233807-234233829 CATCATTTTCAGAAGGAACCAGG + Intergenic
948439278 2:237976194-237976216 CTTGTGCTGCAGATGGAGCCCGG - Intronic
1171037954 20:21731529-21731551 CCAGAGTCTCAGAGGGAGCCTGG + Intergenic
1171144077 20:22766613-22766635 CATGGGTTTCAGGAGGTGCCTGG - Intergenic
1173650985 20:44664050-44664072 CTTAGGATACAGAAGGAGCCAGG + Intergenic
1173900952 20:46588446-46588468 CTTGATTTTCCGTAGGACCCTGG - Intronic
1176113139 20:63419532-63419554 CTAGAGGTTCTGGAGGAGCCAGG - Intronic
1176268866 20:64225087-64225109 GTGGAGTTTCTGAAGGAGCCTGG - Intronic
1178396250 21:32246313-32246335 CTTGTCTTTCAGAACCAGCCAGG + Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1179326982 21:40356714-40356736 CTTCAGTTTCACAAGGGACCAGG - Intronic
1182080286 22:27524076-27524098 CTTTGGTTTCAGAAGGGTCCGGG - Intergenic
1182352288 22:29705721-29705743 GTTGAGTTGCTGAATGAGCCAGG - Intergenic
1183131887 22:35845077-35845099 CTTGGGTGTCAGAGGCAGCCTGG - Intronic
1185084601 22:48733324-48733346 CTTGGGTTTCAGATGGACGCTGG - Intronic
950913307 3:16617137-16617159 CATGAGATTTGGAAGGAGCCAGG + Intronic
952632595 3:35487546-35487568 CTAGAGTTCCAGAGGGAGGCTGG - Intergenic
953156940 3:40384220-40384242 CTTGTGTTGGAGAAGGTGCCAGG - Intergenic
953435622 3:42875020-42875042 CTTCAGTTTCTGAGGGAGCAGGG - Exonic
954076623 3:48186851-48186873 CATGAGATTAAGAAGCAGCCAGG + Intronic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
955856922 3:63282565-63282587 CCTCAGTTTCAGAAGTAGCTGGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
957291507 3:78282833-78282855 TTGGAGTATCAGAAGGAGACAGG + Intergenic
959350545 3:105256478-105256500 CTTCAGTTTTAGCAGGTGCCTGG + Intergenic
959818428 3:110703592-110703614 CATGAGATTCAGGAGGGGCCAGG - Intergenic
960581571 3:119283403-119283425 CATGAGATTCGGAAGGGGCCAGG + Intergenic
960995482 3:123337496-123337518 GTTGAGTTTCAGCGGGAGCAGGG - Intronic
961615129 3:128173239-128173261 CATCAGTTTCCAAAGGAGCCTGG + Intronic
963331251 3:143918944-143918966 CTTGAGTTTCAGAAGTATGGTGG + Intergenic
965653471 3:170958548-170958570 TTAGAGCTTCAGAAGGAGCATGG + Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969125388 4:4944065-4944087 ACTGAGCTTCAGAAGCAGCCTGG + Intergenic
969894854 4:10294007-10294029 CTCTAGTTTCAGAAGGACCAAGG - Intergenic
971900210 4:32649408-32649430 CATGAGATTTAGGAGGAGCCAGG - Intergenic
972976334 4:44640942-44640964 CTTGGGTTTCAGAAAGAGCATGG + Intronic
974864527 4:67563814-67563836 TTTGAGTTTGAGAAGCAGCATGG - Intronic
975952438 4:79789704-79789726 CATGAGATTTGGAAGGAGCCAGG + Intergenic
976171680 4:82311023-82311045 CGTGAGTATCAGCAGTAGCCAGG - Intergenic
978564921 4:110071574-110071596 CTTCAGTTTCAGAACCAGCAGGG + Intronic
978892636 4:113848316-113848338 CATGTGTTGCAGAAGGAACCTGG - Intergenic
980187215 4:129477150-129477172 TTGGATTTTCAGAAGAAGCCAGG - Intergenic
980383258 4:132054830-132054852 CATGAGTTTGAGAAGGAGAGAGG + Intergenic
980998022 4:139799913-139799935 CTTAAGTTTCAGAACAAGTCAGG + Intronic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
982156515 4:152527557-152527579 CTGGAGTTTGAGAACCAGCCTGG + Intronic
982288847 4:153760114-153760136 CCTGAGGTTCTGAAGGAACCGGG - Exonic
983986012 4:174061250-174061272 GCTGAGTGTCAGAAGCAGCCAGG + Intergenic
984041665 4:174742808-174742830 ATTGAGTTTCACAAGGACCAGGG - Intronic
984042077 4:174747496-174747518 TTTGAGTTTTAGAAAGATCCAGG + Intronic
984209777 4:176832184-176832206 CTTGAGCTTTGGAAAGAGCCAGG + Intergenic
985040527 4:185887059-185887081 CTTGAGTTGCACAAACAGCCTGG + Intronic
985907515 5:2852569-2852591 CCAGAGTTCCAGAGGGAGCCTGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986503576 5:8427170-8427192 CATGAGATTCAGAAGGAACTGGG + Intergenic
987070653 5:14334243-14334265 CTCCAGTTGCAGAAGGACCCAGG + Intronic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
989312115 5:40031924-40031946 CTTGAATTTCAGAAGAGACCTGG - Intergenic
991207046 5:64060929-64060951 CTTGAGCTTCATATGGTGCCAGG - Intergenic
991264545 5:64701522-64701544 CTGGAGTTTTAGAAGGGGCTGGG + Intronic
992666350 5:79013147-79013169 ATTGACTGTCAGAAGTAGCCAGG + Intronic
992744893 5:79809891-79809913 CTTGGCTTCCAGCAGGAGCCAGG - Intergenic
993190369 5:84672639-84672661 CTTCAGGTTCAGAAGGTGACAGG + Intergenic
993715957 5:91276091-91276113 CCAGAGTTTCAGAAGGAACATGG + Intergenic
995748675 5:115430828-115430850 CTGGAGTTTGGGAAGGAGCTGGG - Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
1001669986 5:173465844-173465866 CTCAGGTTTCCGAAGGAGCCAGG + Intergenic
1002156470 5:177284889-177284911 CAGGAGTTTGAGAAGCAGCCTGG + Intronic
1003477527 6:6497931-6497953 CTCCAGTTTCAGGAGGAGACCGG - Intergenic
1005170773 6:22981832-22981854 CTGGAGTATCTGAAGGAGTCTGG + Intergenic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1010420725 6:75671979-75672001 CTAAAGTTTCAGAAGTACCCTGG + Intronic
1010549364 6:77201877-77201899 CATGAGTTTTGGGAGGAGCCAGG + Intergenic
1012476505 6:99619359-99619381 GTTTAGTTCCAGAAGGAGCGTGG + Intergenic
1014986850 6:128021778-128021800 CTGGAGTTTTAGAAGGAGCAAGG + Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1018134758 6:160768330-160768352 CTTGTGTGTCAGATGGAGCAGGG - Intergenic
1018310874 6:162507028-162507050 CTTCACTTTCAGAAGAACCCAGG - Intronic
1022060187 7:26785741-26785763 TTTGGGTATCAGATGGAGCCAGG - Intronic
1024194617 7:47047010-47047032 CTGGAGTCTCAAAAAGAGCCAGG + Intergenic
1025034705 7:55586987-55587009 CCTGAGGTTCAGATGGACCCTGG - Intergenic
1025943404 7:66089280-66089302 CTTGAGGGTCATCAGGAGCCCGG - Exonic
1028437822 7:90825172-90825194 CTTGAGTTTCACAATGAAGCTGG + Intronic
1029307633 7:99632115-99632137 CTTAAGCTTCAGAAGGAGCTGGG + Exonic
1030093995 7:105881605-105881627 CCTGAGGTTCAGAAGGATCAAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033243706 7:139701787-139701809 CTTGAGTTTCACAAGGGGAATGG + Intronic
1033520265 7:142153495-142153517 CTGAAGTTTCAGAGGAAGCCAGG + Intronic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1034760260 7:153665772-153665794 CTGGAGGCTCGGAAGGAGCCGGG + Intergenic
1036275704 8:7349672-7349694 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1036345651 8:7960685-7960707 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036840976 8:12121439-12121461 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036862785 8:12367691-12367713 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1037022135 8:13986605-13986627 TTTGAGTTTCAGAAAGAACCTGG + Intergenic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1042806026 8:72771991-72772013 CTTCAGTTGCTGAAGGAGTCAGG + Intronic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1047785389 8:128149344-128149366 CTTGAGTTTCAGCTGAAGCTTGG + Intergenic
1048355635 8:133651893-133651915 CTAGAGTTTCAGAATGAAGCAGG - Intergenic
1049173826 8:141179189-141179211 CTTGAGCTGCAGCAGCAGCCGGG + Intronic
1049717701 8:144100700-144100722 CTTGAGGTTCAGTGGGGGCCGGG - Intronic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1050145707 9:2565252-2565274 CTTCAGTTTCTGAAGTAGCTAGG + Intergenic
1050362206 9:4840872-4840894 GTTGTGCTTCAGAGGGAGCCTGG + Intronic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1051722013 9:20047050-20047072 CTAGAGTTTGGGAAGGAGCCGGG + Intergenic
1052999678 9:34571080-34571102 GCTGAGGGTCAGAAGGAGCCAGG - Intronic
1053155885 9:35778938-35778960 TTTGAGTGACAGAAGGAACCAGG - Intergenic
1055925385 9:81504896-81504918 CTTCAGTATCACAAGGAGCTGGG + Intergenic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1059069393 9:111119829-111119851 CATGAGATTCAGGAGGAGGCAGG - Intergenic
1059589646 9:115644845-115644867 CTTGAGTTTCAGAATCAGCATGG - Intergenic
1060826090 9:126688857-126688879 CTTGAGGATCAGATGGGGCCAGG + Intronic
1203790389 EBV:148430-148452 CTTGAGTCTCCAAAGGACCCAGG - Intergenic
1185807470 X:3071897-3071919 CTTGAGCTTCAGGAGATGCCTGG + Intronic
1187734499 X:22290251-22290273 CGTGAGATTTAGGAGGAGCCAGG + Intergenic
1188243322 X:27813953-27813975 CTTGATTCTCAGAAGGTCCCTGG - Intronic
1189552636 X:42109398-42109420 CTTGGGTTACATAAGGAGCTGGG - Intergenic
1190052500 X:47161156-47161178 CTTGAGTTCCAGACCCAGCCTGG - Intronic
1192209894 X:69121337-69121359 CCTGAGTCTCTGAGGGAGCCTGG + Intergenic
1193965244 X:87976634-87976656 CATGAGATTTAGGAGGAGCCAGG + Intergenic
1197595166 X:128455394-128455416 CATGATTGTCAGAAGCAGCCAGG + Intergenic
1197782215 X:130170765-130170787 CTGGAGTTTCAGAGGGAGTTGGG - Intergenic
1197863787 X:130997182-130997204 ATTGAGGTTTAGAAGGGGCCAGG - Intergenic
1198441630 X:136668858-136668880 TTTGAGATTAAGAAAGAGCCAGG - Intronic