ID: 1104095860

View in Genome Browser
Species Human (GRCh38)
Location 12:125557363-125557385
Sequence GGTCTGCCTCCCCTGAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104095851_1104095860 13 Left 1104095851 12:125557327-125557349 CCCCAATCATGATTCATCTCTTG 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 236
1104095852_1104095860 12 Left 1104095852 12:125557328-125557350 CCCAATCATGATTCATCTCTTGG 0: 1
1: 1
2: 1
3: 13
4: 161
Right 1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 236
1104095850_1104095860 21 Left 1104095850 12:125557319-125557341 CCAATTTACCCCAATCATGATTC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 236
1104095854_1104095860 11 Left 1104095854 12:125557329-125557351 CCAATCATGATTCATCTCTTGGG 0: 1
1: 1
2: 5
3: 29
4: 138
Right 1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 10
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104095860 Original CRISPR GGTCTGCCTCCCCTGAGATC AGG Intronic
900261569 1:1733111-1733133 GGTCTCGAACCCCTGAGATCAGG + Intronic
900458102 1:2787035-2787057 GGTCTGCCTTTCCTGGGAGCAGG + Intronic
900944602 1:5822741-5822763 TGCCTGCCTGCCCTGAGAGCCGG + Intergenic
902018310 1:13326303-13326325 GGTCTGCAACCCCTGACCTCAGG + Intergenic
902525890 1:17057164-17057186 GGTCTTTCTCCCCTAAGAGCTGG + Intergenic
905333198 1:37223235-37223257 GTTCTGCCTCCTGTCAGATCAGG - Intergenic
906139609 1:43526110-43526132 GCTCTGTCTCCCCTGTGCTCAGG - Intronic
907051389 1:51331585-51331607 TGCCTGGCTCCCCTGGGATCTGG - Intronic
907278463 1:53329449-53329471 GGTCTGTCTCCCCACAGGTCAGG - Intergenic
907481400 1:54747847-54747869 TGTCTGCCTCCCCTTACAGCAGG + Intergenic
907498976 1:54864761-54864783 GGTCTGCCTTCCCTATGTTCAGG + Intronic
908446791 1:64206023-64206045 CGTCTGCCTTCCGTGAGATCAGG + Intronic
909760764 1:79283688-79283710 GGTGTGGATCCCCTGAGGTCAGG + Intergenic
910742442 1:90534802-90534824 TGTCTGCCTCCCCGAAGAGCAGG + Intergenic
911719714 1:101177662-101177684 GCTCTGCCTCCTGTCAGATCAGG + Intergenic
912747521 1:112257726-112257748 GGGCTGGATCTCCTGAGATCGGG + Intergenic
915121474 1:153632045-153632067 TGTCTGTCTCCTCTGGGATCTGG + Exonic
916248567 1:162712552-162712574 GGACTGCCCCCACTGGGATCTGG - Intronic
917522677 1:175761016-175761038 GGTCTGCAGGGCCTGAGATCCGG - Intergenic
919464518 1:197913042-197913064 GCACTGCGTCCGCTGAGATCAGG - Intronic
919476124 1:198035452-198035474 GGTCTGACACCCCTGAAACCTGG - Intergenic
919647243 1:200107365-200107387 GTTCTGCCTTCCCTGAGGGCAGG - Intronic
920910543 1:210212532-210212554 GGTCTCCATCTCCTGAGCTCAGG - Intergenic
921264366 1:213410317-213410339 GGTCTGCCTCAGATGAGATGAGG + Intergenic
921485353 1:215708820-215708842 GGTCTGCGTCCCCGGGGTTCTGG + Intronic
922037109 1:221859749-221859771 GGTGTGGCTCACCTGAGGTCAGG + Intergenic
1064864541 10:19864884-19864906 GGGCTTCCTCCCCTGAGTTTGGG + Intronic
1065723509 10:28648587-28648609 CGGGTGCCTCACCTGAGATCAGG - Intergenic
1068080218 10:52310233-52310255 GTTATGACTCCCCTGAGAGCTGG - Intergenic
1069842196 10:71346895-71346917 GGTCTGTCTCCAGTGAGATGTGG + Intronic
1070805826 10:79270163-79270185 GGCCTGCCTCACCCGACATCTGG + Intronic
1072009138 10:91288178-91288200 GCTCTGCTTTCCCTGAGAGCCGG - Intergenic
1072353261 10:94578891-94578913 GCTCTGCCTCCCGTCAGATCAGG - Intronic
1075783299 10:125031270-125031292 GGTCTCCATCTCCTGACATCAGG - Intronic
1076206959 10:128611314-128611336 GGCCTTCCTGCCCTGAGAGCTGG + Intergenic
1076531707 10:131149337-131149359 GGTCTGCCTGATCTGAGAGCAGG - Intronic
1076830999 10:132994151-132994173 GGTCTCAATCCCCTGAGATGTGG + Intergenic
1076919190 10:133442441-133442463 GGTCTGACTTCACTAAGATCTGG - Intergenic
1077000537 11:320067-320089 GCTCTCCCCGCCCTGAGATCAGG + Intronic
1078106228 11:8359739-8359761 GGCCTGTGTCCCCTGAGTTCGGG + Intergenic
1082005885 11:47418740-47418762 TGTCTGCCTTCCCTGGGCTCTGG - Intergenic
1083211737 11:61192090-61192112 GGTCTGCCACTCCTGACCTCAGG - Intergenic
1085033469 11:73286454-73286476 GGTCTGCCTTTCCTGAGGTGGGG + Intronic
1087699069 11:101414735-101414757 GAGCTGGCTCCCCTGAAATCAGG - Intergenic
1089256716 11:117198089-117198111 GCTGTGCCTCCCCTGGGCTCTGG + Intergenic
1090736406 11:129615276-129615298 TGTCTCCCTCCCTTGAGTTCAGG + Intergenic
1091059722 11:132450105-132450127 GGTCTGTCTCCCCTGGGGCCTGG - Intronic
1091548974 12:1523608-1523630 GGTCAGCCTCCCCTGACAGCTGG + Intergenic
1092104398 12:5911163-5911185 GGTCTGCTTCCCTTGAAAGCAGG + Intronic
1092362510 12:7849079-7849101 GGGCTGACTACCCTGAGGTCAGG - Intronic
1092712223 12:11351402-11351424 GGTCTCCATCCCCTGACCTCTGG - Intergenic
1097442537 12:59628590-59628612 TGTCTGCCTCCCCTGCTATGTGG + Intronic
1101210062 12:102526484-102526506 AGTCTGCCTCTCCTGAAACCAGG - Intergenic
1101500573 12:105300285-105300307 GGGCTGGTTCCCCTGATATCTGG + Intronic
1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG + Intronic
1104518732 12:129453024-129453046 GCTCTGCCTCCTGTCAGATCAGG + Intronic
1104674534 12:130703668-130703690 GCTCAGCCTCCCCTGGGGTCGGG + Intronic
1106159899 13:27192088-27192110 GGTCTCCAACCCCTGAGCTCAGG + Intergenic
1106719010 13:32419955-32419977 GGGCAGCCTCCCCTGAGGCCAGG + Intronic
1106866837 13:33973865-33973887 GGTCTGCAACTCCTGACATCAGG + Intergenic
1108461331 13:50670417-50670439 GCTCCGCCTCCTGTGAGATCAGG - Intronic
1108515214 13:51195090-51195112 GCTCTGCCTCCTGTCAGATCAGG - Intergenic
1111310398 13:86476795-86476817 GCTCTGCCTCCTGTCAGATCAGG + Intergenic
1113930880 13:113968256-113968278 GGTCAGGCTGCCCTGGGATCGGG + Intergenic
1116502695 14:45639511-45639533 GCTCTGCCTCCTGTCAGATCAGG - Intergenic
1118597339 14:67446081-67446103 GATCTGCCTCCCATGAGAGCTGG - Intergenic
1119530585 14:75357943-75357965 GGTCTCCAACCCCTGAGCTCAGG + Intergenic
1119562670 14:75603426-75603448 GGTATTCCACCCCTGAGGTCTGG - Intronic
1119619110 14:76118326-76118348 GGCCTGCCTCCGGTGACATCAGG - Intergenic
1121422310 14:93824461-93824483 GGTCTGCCTCCAGGGAGATGTGG + Intergenic
1121847315 14:97184232-97184254 GGTCTGGGTGTCCTGAGATCTGG - Intergenic
1122372834 14:101238150-101238172 GGCCAGCCTCCTCTGAGACCGGG - Intergenic
1122599394 14:102913770-102913792 CGCCTGCCTCCCCTCAGCTCAGG + Intergenic
1123027637 14:105435047-105435069 GGGCTGCTTCTGCTGAGATCAGG - Intronic
1124396553 15:29306962-29306984 GGTCTCAATCTCCTGAGATCAGG + Intronic
1125379802 15:39075624-39075646 GCTCTGCCTTTCATGAGATCTGG - Intergenic
1125761944 15:42102952-42102974 GATCTGCCTGCCCTGGGTTCAGG + Intergenic
1127328025 15:57914344-57914366 TCTCTGTCTCCCTTGAGATCTGG - Intergenic
1127733077 15:61818051-61818073 AGGCTGCCTCCCCTGAGAGTGGG + Intergenic
1128066908 15:64770829-64770851 GGTCAGCCCTCCCTGAGATGTGG - Intronic
1128067188 15:64772705-64772727 GGTCAGCCTTCCCTGAGATGTGG - Intronic
1128160629 15:65421346-65421368 GGTCTGTCTTCCCAGAGCTCAGG - Intronic
1128304894 15:66591900-66591922 CTGCTGCCTCCCCTGAGCTCAGG + Intronic
1128344490 15:66844885-66844907 TGTCTGGCTCCCGTGAGAGCTGG + Intergenic
1128963473 15:72033065-72033087 GGTCTGGAACCCCTGAGCTCAGG + Intronic
1129593238 15:76936534-76936556 GCTCTGCCTCCTATCAGATCAGG - Intronic
1130662699 15:85843107-85843129 AGTCTGCCATCCCTGAGAGCTGG - Intergenic
1135150414 16:20000373-20000395 GGTATGCCTCTCCTAAGCTCTGG + Intergenic
1136186742 16:28592811-28592833 GGTCTCCATCTCCTGAGCTCAGG - Intronic
1136456032 16:30380028-30380050 TATCTGTTTCCCCTGAGATCCGG - Exonic
1136646872 16:31628208-31628230 GGTCTCCCACTCCTGAGCTCAGG - Intergenic
1137754694 16:50892145-50892167 GCTCTGCCTCCCCTGGGTTGGGG + Intergenic
1138203686 16:55108615-55108637 GCTCTGCCTCCTTTCAGATCAGG - Intergenic
1139788323 16:69411989-69412011 GGTCTTCCTACCTTGAGGTCTGG + Intergenic
1139802778 16:69537481-69537503 TGTCTTCCTCACCAGAGATCTGG - Intergenic
1141492003 16:84380120-84380142 GGCCTCCCTCCCCTGTGATCTGG + Intronic
1142595479 17:1027689-1027711 GTGCTGCCTCCCCCGAGAGCTGG - Intronic
1143179548 17:4975577-4975599 AGTCTGCCTACCTTGGGATCTGG - Intronic
1143212451 17:5198682-5198704 GCTCTGCCTCCTGTTAGATCAGG + Intergenic
1143451608 17:7040062-7040084 GATCTGCCTCCCCCTAGAGCAGG + Exonic
1144366090 17:14546226-14546248 GGTCTCCATCTCCTGAGCTCAGG + Intergenic
1144850578 17:18242067-18242089 GATCTGCCTTCCCTGGGCTCAGG + Intronic
1145802209 17:27694956-27694978 GGGCTGGTTCCCCTGATATCTGG - Intergenic
1146056940 17:29586025-29586047 GGCCTCCCTCCCCTGAGCTAAGG + Intronic
1146711204 17:35042988-35043010 TGTTTTCCTCCCCTGAGTTCTGG - Intronic
1148611635 17:48968558-48968580 GGTCTCCTTCCCCTGATTTCTGG + Exonic
1148652431 17:49259839-49259861 GGTCTCCCTCCCCCGTGGTCTGG + Intergenic
1148844528 17:50521500-50521522 GGGCTTCCCTCCCTGAGATCAGG + Intronic
1151329905 17:73400564-73400586 GGTCTGGGTCCCCTCAGAGCAGG - Intronic
1151815269 17:76468616-76468638 GGCCTGCCTCCCTGGAGATGAGG + Intronic
1158946288 18:62449823-62449845 GGTTTGCTTCTCCTGAGAGCCGG + Intergenic
1159570622 18:70108047-70108069 GGTGTGGATCACCTGAGATCAGG + Intronic
1160380796 18:78453840-78453862 GGTCTTCCTCCCATGAGCTGAGG - Intergenic
1165396014 19:35563826-35563848 TGTCAACCTGCCCTGAGATCAGG + Intergenic
1168132419 19:54330020-54330042 GGACTTCCTCACCTGAGAACAGG + Intergenic
1168659322 19:58154223-58154245 GGTCTACAACCCCTGAGCTCAGG + Intronic
927359716 2:22218590-22218612 AGTTTCTCTCCCCTGAGATCTGG + Intergenic
931383706 2:61777513-61777535 GGGCAGCCTCACCTGAGGTCTGG - Intergenic
931642684 2:64395726-64395748 GCTTTGCCTGCCCTGAGCTCAGG - Intergenic
932214731 2:69959298-69959320 GGCCACCCTCCCCTGAGAACAGG + Intergenic
933015121 2:77114585-77114607 GGGCTGGTTCCCCTGATATCTGG - Intronic
933423116 2:82077282-82077304 GCTCTGCCTCCTGTCAGATCAGG - Intergenic
934564423 2:95330428-95330450 GGTCACCCTGCCCTGAGAGCAGG - Intronic
935714987 2:105931900-105931922 AGTCTCCCTCCCCAGAGATGAGG - Intergenic
937251044 2:120524007-120524029 GGCCTGCCTCCTCTGAGACTGGG - Intergenic
937980565 2:127612235-127612257 TGTCTCCCTCCACAGAGATCTGG + Intronic
943770064 2:191706546-191706568 GGTCAGCCTCCTCTGAAATTGGG - Intergenic
943801136 2:192059415-192059437 GTTCGGTCTCCCCTGAGATGAGG - Intronic
947715892 2:232338640-232338662 GGGCTGCCTTCTCTGAGCTCTGG - Intronic
947734916 2:232449386-232449408 GGGCTGCCTTCTCTGAGCTCTGG - Intergenic
948542826 2:238702467-238702489 CGCCAGCCTCCCCTGACATCCGG - Intergenic
1170315717 20:15039344-15039366 GACCTACCTCCCCTAAGATCAGG - Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1171240783 20:23565626-23565648 GGTCTTCCTCCCCTGCCTTCTGG - Intronic
1171248240 20:23630289-23630311 GCTCTGGCTCCCTTGAGACCAGG - Intronic
1171388199 20:24784394-24784416 GCTTTGCCTCTCCTCAGATCGGG + Intergenic
1172078064 20:32314927-32314949 GGTCTGGCTTCCCTGAGATAAGG - Intronic
1173518403 20:43681587-43681609 TGGCTCCCTCCCATGAGATCAGG + Intronic
1173719027 20:45237115-45237137 GCTCTGCCTCCTGTCAGATCAGG + Intergenic
1173783454 20:45775231-45775253 GGTTTGCCACACCTGAGAACAGG + Intronic
1173856871 20:46255850-46255872 GGACCGCCTCCCATGAGACCTGG + Intronic
1174302819 20:49594655-49594677 GCACTGCCTCCCTTGGGATCAGG - Intergenic
1174364244 20:50046909-50046931 GGTCTGCCTGCCCTGTGGCCTGG - Intergenic
1178403521 21:32306718-32306740 GGTCCGCCTCCCCGCAGATGAGG + Exonic
1181588233 22:23866258-23866280 GGCCAGCCTCCCCTGACATTGGG - Intronic
1183058720 22:35322464-35322486 TGTCTGGCCGCCCTGAGATCTGG - Intronic
950196798 3:11015006-11015028 GGTCTGCATTCCCTCAGAGCTGG - Intronic
950538424 3:13595152-13595174 GCTCTGCCAAGCCTGAGATCCGG + Intronic
954255758 3:49404710-49404732 GGTCTCCATCTCCTGAGCTCAGG - Intronic
955370234 3:58344897-58344919 GGGCTGCCTCCCTTCAGGTCTGG - Intronic
955738822 3:62067746-62067768 GCTCTGCCTCCTGTCAGATCAGG - Intronic
957353240 3:79052728-79052750 GGGCTGGTTCCCCTGACATCTGG + Intronic
959921615 3:111874467-111874489 TGTCTGCAGCCCCTGAGATTTGG - Intronic
960775422 3:121246144-121246166 GCTCTGCCTCCTGTTAGATCAGG + Intronic
961394201 3:126575217-126575239 TGAATGCCTCCCCTGGGATCGGG + Intronic
962951052 3:140219308-140219330 GACCTGCCTTCCCTGAGAGCAGG + Intronic
963040888 3:141069067-141069089 GGCCTGCATCCCATGACATCTGG - Intronic
964075159 3:152684324-152684346 GGTCTCCCTCCACTGAGAGCTGG - Intergenic
964574450 3:158149388-158149410 GGACTGCCTGCCTTAAGATCAGG + Intronic
965067123 3:163864303-163864325 GGTCATCTTCCCCTGAGGTCTGG - Intergenic
967250909 3:187537017-187537039 GCTCTGCCTCCTGTCAGATCGGG - Intergenic
969326008 4:6444264-6444286 GGTCTGCTCCCGCGGAGATCAGG + Intronic
969591759 4:8126248-8126270 GGTCTGGCTGCCCAGAGATGAGG + Intronic
974014734 4:56638728-56638750 GGTCTCCAACCCCTGAGCTCTGG + Intergenic
974605698 4:64147032-64147054 GGGCTGGTTCCCCTGATATCTGG - Intergenic
978453248 4:108859897-108859919 GGTTTGCCTCCTTTGAGATAAGG - Intronic
980873134 4:138632922-138632944 TTACTGCCACCCCTGAGATCAGG + Intergenic
982370447 4:154627432-154627454 CGTCTCCCTCCCCTGGGCTCCGG + Intronic
982602647 4:157470779-157470801 GGTTTCCCTCCCCTGAGCTATGG - Intergenic
982878018 4:160671747-160671769 TGTCAGCCTCCCCTGAAATATGG - Intergenic
984243578 4:177247756-177247778 GGTCTCCATCTCCTGAGCTCAGG + Intronic
984353442 4:178625407-178625429 GGAATGCATCCCCTGAGTTCAGG - Intergenic
984451144 4:179904331-179904353 TGTCTGCCTCCCCTGAGGTTAGG + Intergenic
984507903 4:180642648-180642670 GGTCTCCAACCCCTGAGCTCAGG + Intergenic
985132766 4:186755990-186756012 GGTCTGCCTCCACTGCCATAGGG + Intergenic
986201298 5:5581296-5581318 GGTTTGCCACCTCTGAAATCTGG + Intergenic
986710016 5:10481749-10481771 CATCTGCATCCCCTGAGCTCAGG - Intergenic
987007127 5:13722233-13722255 GCTCTGGCTCCCCTTTGATCCGG - Intronic
987318844 5:16749134-16749156 GGTTTCCCTCCCCTGAGGCCTGG + Intronic
988024406 5:25666465-25666487 GGTCTCCCACTCCTGAGCTCAGG + Intergenic
989391113 5:40901947-40901969 GGTCTTGCTCTCCTGAGCTCAGG - Intergenic
990273975 5:54175866-54175888 GGTCTCCATCTCCTGAGCTCAGG + Intronic
992221712 5:74580080-74580102 GGTCTTCCTACCCTCAGATTTGG + Intergenic
992542344 5:77777464-77777486 GGTGGGCCTCACCTGAGGTCAGG - Intronic
994395739 5:99224681-99224703 GGTGTACATCCCCTGAGATATGG + Intergenic
996499111 5:124196966-124196988 AGACTGGCTGCCCTGAGATCAGG - Intergenic
999122587 5:149220574-149220596 GTTCTGCTACCACTGAGATCTGG + Intronic
1002492049 5:179585347-179585369 GGGCAGCCTCACCTGAGGTCAGG + Intronic
1002661059 5:180791444-180791466 GATCTGACTCCCTTGAGAACGGG + Exonic
1003076415 6:2987319-2987341 GCTCTGCCTCCTATCAGATCAGG - Intergenic
1003141809 6:3477987-3478009 GGGCTGCCTTCCCTCTGATCTGG + Intergenic
1003604077 6:7543024-7543046 GGTCTGTTTCCGCTGGGATCCGG - Intronic
1003850772 6:10220366-10220388 GCTCTGCCTCCTGTCAGATCAGG - Intergenic
1005524098 6:26628525-26628547 GGACTGCCTAGCCTGAAATCTGG + Intergenic
1005927230 6:30453636-30453658 GGTCTGCAGGCCCTAAGATCTGG - Intergenic
1006595409 6:35189574-35189596 GCTCTGCCTCCTGTCAGATCAGG + Intergenic
1006940929 6:37751857-37751879 GGCTTGCCTCTTCTGAGATCAGG + Intergenic
1007072115 6:39045462-39045484 GGTCCACCTGCCCTGAGAGCTGG - Intergenic
1007290132 6:40779507-40779529 GCTCTCCCTCCACTGAGATTGGG + Intergenic
1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG + Exonic
1015999633 6:139029447-139029469 GGTCTGCCTCCCCCGTGGCCCGG - Intronic
1016168671 6:140979951-140979973 GGTCAGCCTCCCATGAGTTCTGG - Intergenic
1016340236 6:143054332-143054354 GGTCTCCAACTCCTGAGATCAGG + Intergenic
1016431474 6:143990335-143990357 GGTCTCCATCCCCTGACCTCGGG + Intronic
1016804854 6:148202439-148202461 GGTCTGCCCTCCCTGAGCCCTGG + Intergenic
1017437057 6:154425572-154425594 TGTCCTCCACCCCTGAGATCCGG - Intronic
1019622362 7:1998794-1998816 GGTCTGGTTCCCCTGAGTGCAGG - Intronic
1024086082 7:45892669-45892691 GGTTGGGCTCCCCTGACATCAGG + Intronic
1024552729 7:50577064-50577086 GGACTGGTTCCCCTGATATCTGG + Intergenic
1025975027 7:66362863-66362885 GGTCTCCAACCCCTGATATCAGG - Intronic
1026020204 7:66700015-66700037 GCACTGCCTCCCCTGAGTTGGGG - Intronic
1026791670 7:73336651-73336673 GGTCCACCTCCCCCGAGAGCTGG + Intronic
1027417162 7:77985594-77985616 GGTCAGCCTCCCCTGCGAGGAGG + Intergenic
1029445392 7:100609465-100609487 GGTGTGCATCACCTGAGATTGGG - Intergenic
1030117713 7:106074720-106074742 GGTCTGCCTCCCCGTAGAAGAGG - Intergenic
1033609606 7:142953188-142953210 TCTCTGCCTCCCCTGATACCTGG - Intronic
1034690320 7:153008522-153008544 TGCCTGCCTCCCCTGGGAGCAGG - Intergenic
1035298431 7:157880585-157880607 GGCCTGCCTGCCCTCAGAGCTGG - Intronic
1044890431 8:96829295-96829317 GGACTGTGTCTCCTGAGATCTGG - Intronic
1045059513 8:98399822-98399844 GGAATGCCAGCCCTGAGATCTGG + Intergenic
1046525331 8:115375667-115375689 GGTCTGCAACTCCTGAGAACAGG - Intergenic
1047214415 8:122864894-122864916 GGTCTTCTTCCCCTGGGGTCTGG + Intronic
1047282225 8:123455639-123455661 GGTCTGGAACCCCTGAGCTCAGG + Intronic
1048270733 8:133026130-133026152 GGGCTGCCACTGCTGAGATCAGG - Intronic
1048339744 8:133529451-133529473 TGTCTGCCTCCCCTGTTAGCTGG - Intronic
1049013576 8:139904419-139904441 GGAGGGCCTCCCCTGAGGTCAGG + Intronic
1049183364 8:141234957-141234979 GGTCTGCCTTCCCCGAGGACAGG + Intronic
1049441041 8:142609954-142609976 GGTCAGCCTCCCCTGACTTTGGG - Intergenic
1055881524 9:81009874-81009896 GGTCTGACACCTCTGAGACCTGG - Intergenic
1056025348 9:82489035-82489057 GGGCTGCCTTCTCTGGGATCAGG + Intergenic
1056644872 9:88402207-88402229 GGTCTGGGTCCCCTGACCTCAGG + Intronic
1061041773 9:128144818-128144840 GGTCTGGCTCTCCTGAAAGCTGG - Intergenic
1061874267 9:133536076-133536098 GTTCTGCCTCACCTGAGTGCCGG + Intronic
1062215784 9:135389150-135389172 GGTCTGGAGCCCCTGAGCTCTGG - Intergenic
1062532609 9:137008488-137008510 GGTCTGCCCCCACGGAGCTCCGG - Exonic
1185948864 X:4408100-4408122 GCTCTGCCTCCTGTCAGATCAGG - Intergenic
1186787558 X:12967933-12967955 GCTATGCCTCCTGTGAGATCAGG + Intergenic
1186854529 X:13612926-13612948 GGTCTTGCACCCCTGAGCTCAGG - Intronic
1189324804 X:40105844-40105866 GGGCCGCCACCCCTGGGATCCGG + Intronic
1195023416 X:100851693-100851715 GGTCTCCAACTCCTGAGATCAGG - Intronic
1195465794 X:105177179-105177201 GCTCTGCCTCCTGTCAGATCAGG + Intronic
1198633947 X:138674510-138674532 GGTCTGCATCACCTAAGATGAGG + Intronic
1199396432 X:147343973-147343995 GATCTGCCTCCCTTTAGAACTGG + Intergenic
1200308795 X:155056619-155056641 ACTCTGCCTCTCCTGACATCTGG + Exonic
1202247388 Y:22833837-22833859 GGGCTGGTTCCCCTGATATCTGG - Intergenic
1202400376 Y:24467585-24467607 GGGCTGGTTCCCCTGATATCTGG - Intergenic
1202470404 Y:25202501-25202523 GGGCTGGTTCCCCTGATATCTGG + Intergenic