ID: 1104097385

View in Genome Browser
Species Human (GRCh38)
Location 12:125569935-125569957
Sequence CAATCCATGGTGACTTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104097385 Original CRISPR CAATCCATGGTGACTTGAAG TGG Intronic
900691659 1:3984234-3984256 AAAGCCGTGGGGACTTGAAGAGG + Intergenic
904219205 1:28951175-28951197 CCATCCTTGGTAAATTGAAGAGG - Intronic
904320047 1:29690682-29690704 CACTCCATCCTGACTGGAAGAGG - Intergenic
913588527 1:120299992-120300014 CTCTCCTTGCTGACTTGAAGTGG - Intergenic
913619658 1:120598377-120598399 CTCTCCTTGCTGACTTGAAGTGG + Intergenic
914570545 1:148911864-148911886 CTCTCCTTGCTGACTTGAAGTGG - Intronic
914602286 1:149218405-149218427 CTCTCCTTGCTGACTTGAAGTGG + Intergenic
917939901 1:179908287-179908309 CAATCCGTGGTGAATTAAAAAGG - Intronic
920323372 1:205141947-205141969 CCTTCCCTGGTGACTAGAAGTGG + Intergenic
1068842317 10:61629533-61629555 CATGCCATTGTGCCTTGAAGGGG - Intergenic
1069550872 10:69363107-69363129 CAAACCATAGTCACATGAAGTGG - Intronic
1075463779 10:122636298-122636320 CAAGCCCTGGTGACCTGAAAGGG - Intronic
1089162690 11:116451721-116451743 CAGTCCATAGAAACTTGAAGAGG - Intergenic
1089363832 11:117909058-117909080 TGATCCTTGGTGACTTGCAGAGG - Intronic
1091238082 11:134034816-134034838 CAAGCCATGGTGGCTGGTAGGGG - Intergenic
1092300359 12:7242601-7242623 CAATCCATGATGAAATGCAGGGG - Intergenic
1094194228 12:27729405-27729427 CAAGCTATGGTTACTTGAAAAGG - Intronic
1099592386 12:84611178-84611200 TAATCCATATTGACTTTAAGAGG - Intergenic
1103561692 12:121796220-121796242 GAATTCCTGGTGACTGGAAGGGG - Intronic
1104097385 12:125569935-125569957 CAATCCATGGTGACTTGAAGTGG + Intronic
1104751320 12:131241309-131241331 CAATTCATGGTGACGTGATATGG + Intergenic
1107344363 13:39443050-39443072 CAAGGCATGGTGTCTAGAAGTGG + Intronic
1111915887 13:94359902-94359924 GAACCCATGGGGACTTGAAAGGG - Intronic
1117179421 14:53177164-53177186 CATTCCTTGGAGACCTGAAGGGG - Intergenic
1120327900 14:83052682-83052704 TCATCCATGGTGAAATGAAGGGG - Intergenic
1122308554 14:100780535-100780557 CACTCCATGGTGACCTGCCGTGG + Intergenic
1125315910 15:38430948-38430970 CAATCCATAGTAACTTTAACTGG + Intergenic
1127510439 15:59635467-59635489 CAACCCATGGTCACATGATGAGG - Intronic
1128738731 15:70068840-70068862 AAATCCATTCTGACCTGAAGTGG - Intronic
1131756611 15:95570816-95570838 CAATCTATGATCACTTAAAGTGG - Intergenic
1136640639 16:31562235-31562257 CAATCTATTGTTACTGGAAGCGG + Intergenic
1137703469 16:50517422-50517444 CAGTCCATGAAGACTAGAAGAGG - Intergenic
1138277123 16:55743204-55743226 CAATCCAAGGTGCCTTGACAAGG + Intergenic
1140842380 16:78852027-78852049 CAATCAAGAGTGACTTGAACTGG + Intronic
1141932011 16:87211741-87211763 CAAACCAGGTTGACTGGAAGTGG + Intronic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1147020144 17:37525201-37525223 CAATTTAAGGTGACTTGTAGAGG - Intronic
1148712279 17:49690539-49690561 CAATCCAGGGTGACATGCAGTGG - Intergenic
1150614025 17:66755147-66755169 CATTCCATGAAGACTTGAAACGG + Intronic
1153111409 18:1593325-1593347 CAATCCATGGTGAGTAACAGTGG - Intergenic
1153143651 18:2003022-2003044 CGATCCATGGTGAAATGCAGGGG - Intergenic
1153404013 18:4715164-4715186 CAGTCCATTGTGTATTGAAGAGG + Intergenic
1153637756 18:7127905-7127927 GAATCCATGGGAACTTGGAGAGG + Intergenic
1155606490 18:27612213-27612235 CAAACAATGGTGACTTTAGGGGG + Intergenic
1160334452 18:78026248-78026270 CAATCCATGGTGACAGCCAGGGG - Intergenic
1162673502 19:12279000-12279022 CCATCCATGAAGACTGGAAGAGG + Intronic
1162776035 19:12980043-12980065 CAAACCAGGGTGAGTGGAAGGGG + Intergenic
1163003733 19:14384505-14384527 TAATCCAGGGAGACCTGAAGGGG - Intronic
1163361446 19:16848933-16848955 CAGTCCATGGTTTCTTTAAGTGG + Intronic
1165147591 19:33741407-33741429 CAGTTCATGTTGACTTGCAGTGG - Intronic
1168375941 19:55879357-55879379 CGATCCATGGTGAAATGCAGAGG + Intronic
927433524 2:23047527-23047549 GAATCCTTGGTGACTTGGTGGGG - Intergenic
930935130 2:56939759-56939781 CAATCCCTGCTCACTGGAAGAGG - Intergenic
934488729 2:94742484-94742506 CAATACTTGGTGATTTGAAATGG - Intergenic
935934140 2:108163440-108163462 CAGTTCAGGGTGACTTGGAGAGG + Intergenic
941128034 2:161610561-161610583 CACTCCATAATGACTGGAAGTGG + Intronic
942705154 2:178763184-178763206 CAATCAGTTATGACTTGAAGTGG + Intronic
945367068 2:208967382-208967404 ATCTCCATGTTGACTTGAAGAGG - Intergenic
946352993 2:219167945-219167967 AAATCCATGGTGCCTTGGTGGGG + Exonic
947377922 2:229515940-229515962 CAATCAAAGCTAACTTGAAGAGG - Intronic
1171328369 20:24316398-24316420 AAATCCAGTGTGACTTAAAGGGG + Intergenic
1173618232 20:44416622-44416644 CTATCCATGGGGAATAGAAGGGG + Intronic
1176335125 21:5589926-5589948 AAATGTAAGGTGACTTGAAGGGG - Intergenic
1176392632 21:6231022-6231044 AAATGTAAGGTGACTTGAAGGGG + Intergenic
1176468787 21:7085152-7085174 AAATGTAAGGTGACTTGAAGGGG - Intronic
1176492348 21:7466930-7466952 AAATGTAAGGTGACTTGAAGGGG - Intergenic
1176508294 21:7671453-7671475 AAATGTAAGGTGACTTGAAGGGG + Intergenic
1177938591 21:27381312-27381334 AAATACATGGTCACTTTAAGTGG + Intergenic
1178189498 21:30264026-30264048 CAATCAATTGAGACTTGCAGTGG + Intergenic
1179183493 21:39064556-39064578 CCATGTCTGGTGACTTGAAGTGG - Intergenic
953468982 3:43150717-43150739 GAATCCATGTTGGCTGGAAGGGG + Intergenic
953633256 3:44638602-44638624 CAGTACATGTTGACTAGAAGTGG + Intronic
954816488 3:53285496-53285518 CAAGTCATGGAGACTTGAAAAGG - Exonic
955191082 3:56762155-56762177 CAGTCCACGGTAACTAGAAGAGG + Intronic
955359286 3:58259038-58259060 CAGTCCATGATGCCTTGACGAGG - Intronic
956968219 3:74489287-74489309 CAGTCCATGGTTACTTGTTGGGG - Intronic
957150196 3:76476612-76476634 CAATCCAGGGTGATTGGGAGAGG + Intronic
958007102 3:87826096-87826118 CCATCAATGGTGCCTAGAAGTGG - Intergenic
961571913 3:127805370-127805392 CACTCCATTATGACCTGAAGGGG + Intronic
964372802 3:156018795-156018817 GAATCCATGGTGAGTTGACCTGG + Intergenic
967212902 3:187184637-187184659 GAACCCAGGGTGACTTGTAGAGG - Intergenic
967284636 3:187856659-187856681 CAATTCATGGTCACATGAAAGGG - Intergenic
970417605 4:15874835-15874857 CAATCCCTGGAGACTAGAACCGG + Intergenic
970484542 4:16511309-16511331 CAATTAATGATGACTTGAATCGG + Intronic
970508009 4:16752539-16752561 AACTCCATGGTAATTTGAAGTGG + Intronic
972941858 4:44205881-44205903 CATTCCATGGGGAGTGGAAGGGG - Intronic
974286470 4:59874743-59874765 CAATCAATGGTGAATATAAGTGG - Intergenic
974369766 4:61000248-61000270 CAGTCCATAGAGACTGGAAGAGG + Intergenic
975524698 4:75336123-75336145 AAGTCAATGGTAACTTGAAGGGG - Intergenic
975717725 4:77221194-77221216 TACTCCATGGTGGCTTGAACTGG + Intronic
981419666 4:144534683-144534705 GAATCCATGGTGAAATGCAGGGG - Intergenic
982626845 4:157778221-157778243 AAGTCAATGGTGACTTGATGGGG + Intergenic
982686945 4:158501865-158501887 AAGTCCATGGTAGCTTGAAGGGG + Intronic
983005152 4:162475485-162475507 CAATCCTTGGTCTCTTTAAGTGG + Intergenic
983356674 4:166669191-166669213 CTATACATGGTGACATTAAGTGG + Intergenic
987489151 5:18554631-18554653 CAATACCTGATGATTTGAAGTGG + Intergenic
992382338 5:76250583-76250605 CAATCCATTATGACTCAAAGAGG - Intronic
993011074 5:82483715-82483737 CAAGCCACTGTGACTGGAAGTGG + Intergenic
994135710 5:96283938-96283960 CAACCCATGGTGAAGAGAAGGGG - Intergenic
995890042 5:116940834-116940856 AAATACTTGTTGACTTGAAGTGG + Intergenic
998671774 5:144361492-144361514 GAAATCATGGAGACTTGAAGTGG - Intronic
999385092 5:151148401-151148423 CCATCCTTGTTGACTTGAAAAGG - Intronic
1001235973 5:170029921-170029943 CCATGCATGGTGACAGGAAGGGG - Intronic
1002947284 6:1774929-1774951 CATTCCAGGGGGAGTTGAAGGGG + Intronic
1007552709 6:42742396-42742418 CAATCCATGGTGACCTGGCAGGG - Intergenic
1009794095 6:68443908-68443930 AAATCCCTGGTGGCTTGTAGGGG + Intergenic
1013351837 6:109312890-109312912 CCAAGCATGGTGACATGAAGGGG - Intergenic
1013743460 6:113317140-113317162 CAATCAATGGTTAGTTTAAGGGG + Intergenic
1014007338 6:116435395-116435417 AAACCCTTGGTGACTGGAAGAGG - Intronic
1017598885 6:156059731-156059753 CAGGCCATGGTGATTTTAAGGGG - Intergenic
1020033623 7:4950538-4950560 CAATCCATAGAGACAGGAAGTGG - Intronic
1033430980 7:141289404-141289426 CAATCCAGCTTGACTTGAAAAGG + Intronic
1034911104 7:154999581-154999603 CAAGCCTTGGTGTCTGGAAGGGG + Intronic
1037567476 8:20129965-20129987 GGATCCAGGGTGAGTTGAAGTGG + Intergenic
1041826344 8:62099873-62099895 TAATCCATGGTGAAATGCAGGGG + Intergenic
1048285668 8:133139475-133139497 CAATCCCATGTGACTTCAAGAGG - Intergenic
1049527530 8:143135664-143135686 CAGTCCCTGGTGTCTTGAGGGGG - Intergenic
1052017990 9:23491636-23491658 GAATCAATGGTGGCTTGATGAGG + Intergenic
1052986537 9:34491969-34491991 CCATCCAGGAGGACTTGAAGGGG - Intronic
1053669053 9:40341873-40341895 CAATACTTGGTGATTTGAAATGG + Intergenic
1053918853 9:42968128-42968150 CAATACTTGGTGATTTGAAATGG + Intergenic
1054380190 9:64481911-64481933 CAATACTTGGTGATTTGAAATGG + Intergenic
1054515558 9:66034419-66034441 CAATACTTGGTGATTTGAAATGG - Intergenic
1055992614 9:82123818-82123840 CAATCCATGGTCAGGTGAGGTGG + Intergenic
1058360326 9:104138687-104138709 CAATCCATGGTAACTATGAGTGG - Intronic
1060127968 9:121068095-121068117 CAATCTATGTTGATTAGAAGTGG - Intergenic
1203426515 Un_GL000195v1:44994-45016 AAATGTAAGGTGACTTGAAGGGG + Intergenic
1203455050 Un_GL000219v1:158993-159015 CAATCCATGGGAACTTACAGCGG - Intergenic
1188910029 X:35835457-35835479 CAATCCATGATGTCTTCAACTGG + Intergenic
1192992522 X:76475825-76475847 AAGTCAATGGTCACTTGAAGGGG - Intergenic
1193284178 X:79692547-79692569 AAATCCATGGTAGCTTGATGGGG + Intergenic
1198847411 X:140927082-140927104 CAAACCATGGTGGGTTGAATAGG - Intergenic