ID: 1104099809

View in Genome Browser
Species Human (GRCh38)
Location 12:125596566-125596588
Sequence TTTTGAGGAGGGGCCCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104099809 Original CRISPR TTTTGAGGAGGGGCCCTTTA AGG (reversed) Intronic
902837379 1:19055510-19055532 TTTTGAGGACATGCACTTTAGGG - Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
906100329 1:43256215-43256237 TTCTGAAGAAGTGCCCTTTAAGG - Intronic
906194909 1:43923977-43923999 TTTGGAGGTGGGGGCCTTTGGGG - Intronic
906684284 1:47752935-47752957 TCTTTCGAAGGGGCCCTTTAAGG - Intergenic
908104306 1:60825566-60825588 TTATGAGGAAGGTCCTTTTAAGG + Intergenic
916160939 1:161913997-161914019 TTTTGAAGAGGAGCCTTTCATGG + Intronic
919055535 1:192565350-192565372 TTTTGAGCAGGGGTCATTTTTGG - Intergenic
923415590 1:233756511-233756533 TTTTGAGGAGGAGAGCTTGATGG + Intergenic
1065404452 10:25348243-25348265 TTTTGGGTAGGAGGCCTTTAGGG + Intronic
1068227906 10:54130594-54130616 TTTTAAGAACGGGCCTTTTATGG - Intronic
1068424261 10:56837487-56837509 TTTCGAGGAGGGAGGCTTTATGG - Intergenic
1074611097 10:115022678-115022700 ATTTGAGAAGGGGCCCATTTGGG + Intergenic
1077461247 11:2711838-2711860 TTCTGAGGAGGGTGCCTTTGAGG + Intronic
1078722793 11:13899330-13899352 TTTTGAGAAAGGGCTCTTTAGGG - Intergenic
1080399923 11:31924197-31924219 TTTTGAGGAGTGTGCATTTAAGG + Intronic
1084010589 11:66346409-66346431 TTATGAGGAGTGGCCCTGGATGG - Intronic
1089069385 11:115687719-115687741 TTTTGAGGAGATGCCATTCAGGG - Intergenic
1090938325 11:131365289-131365311 TTCTGGGGAGAGTCCCTTTAAGG + Intergenic
1092163126 12:6327157-6327179 TTTGGAGGAGGGGCCATTTCTGG + Intronic
1094615687 12:32034285-32034307 CTTTGAGGAGGAGGCCTTTCCGG - Intergenic
1096582342 12:52594161-52594183 TTTTGAGGAGGGGGCTTCCAGGG - Intronic
1100455701 12:94749785-94749807 TTTGGTTGAGGGGCCCTATACGG - Intergenic
1101966124 12:109283146-109283168 ATTTGAGGAGGGGCCATCCAAGG - Intronic
1102011131 12:109619029-109619051 TTCTGAGAAGGGACTCTTTATGG + Intergenic
1104099809 12:125596566-125596588 TTTTGAGGAGGGGCCCTTTAAGG - Intronic
1104241967 12:126998938-126998960 GGCTGAGGAGGAGCCCTTTAAGG - Intergenic
1106286436 13:28321910-28321932 TTTTGTGGGAGGGCCCTATATGG + Intronic
1106701837 13:32237597-32237619 TTTTGAGGAGAGGCCTTGTTGGG - Exonic
1107500418 13:40968468-40968490 CATTGAGGAGGGGCACTATATGG - Intronic
1109286290 13:60411870-60411892 GTTTGAGGAGCAGCACTTTAGGG + Intronic
1110395307 13:75023234-75023256 TTTGGAGGTGGGGCCCTTAGTGG + Intergenic
1111928089 13:94484310-94484332 CTGTGAGGATGGCCCCTTTAGGG + Intergenic
1120142602 14:80945318-80945340 TTTTGAAAATGGGACCTTTAAGG - Intronic
1120932835 14:89866212-89866234 TTTTGGGCAGGGGCCCTTCTGGG + Intronic
1121926422 14:97931308-97931330 CTTGGAGGAGGTGCCGTTTAAGG + Intronic
1129496523 15:75987464-75987486 TTATGAAGAGGGGCCTTTTGGGG + Intronic
1129677230 15:77638253-77638275 TAGTGCTGAGGGGCCCTTTACGG - Intronic
1133348032 16:5083454-5083476 ATTTGAGGAGGGAGCCTTAAGGG - Intronic
1133528294 16:6627911-6627933 AGTTGAGGATGGCCCCTTTAGGG - Intronic
1134355062 16:13474730-13474752 CTCTGAGGAGGTGCCTTTTAAGG + Intergenic
1135671929 16:24382721-24382743 TTTTGAGGAAGGGACATTTGGGG + Intergenic
1136277581 16:29187911-29187933 ATTTGAAGATGGGGCCTTTAAGG - Intergenic
1142024932 16:87807288-87807310 GGTTGGGGTGGGGCCCTTTAAGG + Intergenic
1142081959 16:88153953-88153975 GTTTGAAGATGGGGCCTTTAAGG - Intergenic
1144540933 17:16142048-16142070 TTTTGAGGAGGGGGAGTTTGAGG - Intronic
1146428633 17:32768561-32768583 TGTTGAGGAAGGGCCCTGGAAGG + Intronic
1146571322 17:33955742-33955764 GTTGGAGGAGGGGCCCTGTTGGG - Intronic
1152261206 17:79268315-79268337 TTTTGAGTAGGGGCAGTTTCTGG - Intronic
1153674824 18:7447583-7447605 TTAAGAGGTGGGGCCCTTTTGGG - Intergenic
1155627084 18:27846780-27846802 TGTTGAGGCGGGGACCTTTTGGG - Intergenic
1161272504 19:3397764-3397786 TTCTGAGCACTGGCCCTTTAAGG - Intronic
1162744391 19:12790570-12790592 ATGTGAGGAGGGGGCCTTGAGGG - Intronic
1165945775 19:39441367-39441389 GTTTGAGGAGGGACCATCTATGG + Intronic
926855371 2:17250799-17250821 TGATGAGGAGGGGGCGTTTAAGG - Intergenic
926942147 2:18149831-18149853 TATTGAGAAGTGGGCCTTTAAGG - Intronic
928180089 2:29062695-29062717 TTTTAAGATGAGGCCCTTTACGG + Exonic
928645417 2:33347206-33347228 TTTAGGGAAGGGGCTCTTTAAGG - Intronic
932403165 2:71496062-71496084 TTTTCAGGAGGTGGCCTTGAAGG - Intronic
933327161 2:80852649-80852671 TTTTGAAGAGGGGACCTTGGAGG + Intergenic
933724256 2:85417794-85417816 TTTTGAGGTGAGGCTCTTGAAGG + Intronic
940800469 2:158127162-158127184 TTTTGAGGAGGTGAGATTTAGGG - Intronic
946574041 2:221055089-221055111 GTTTGAGGCTGGGCCTTTTATGG - Intergenic
949062240 2:241968051-241968073 GTTGGAGGAGGGGCCCTTGGTGG + Intergenic
1169076261 20:2761404-2761426 TATTGAGGATGGAGCCTTTAAGG + Intergenic
1170371169 20:15649722-15649744 TTTTGAGGAGGGGATCTTTGGGG + Intronic
1173799695 20:45887185-45887207 CTTTGAGGAGGGGGCCCTGAGGG + Intronic
1174847488 20:53957141-53957163 TTTTGAAGAGGTGACATTTATGG + Intronic
1175592323 20:60203010-60203032 TTTTGAGGAGGGTCCGGTCAGGG + Intergenic
1178287447 21:31337360-31337382 TTTGGTGGAGGGTGCCTTTAGGG - Intronic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1181967918 22:26669552-26669574 TTTTGGAGATGGGACCTTTAAGG - Intergenic
950221664 3:11201007-11201029 TTCTGAGGAGAGGCCCTCAAAGG - Intronic
950979221 3:17283998-17284020 TTCTGAGGAGGTGCCATTTCAGG - Intronic
952585306 3:34885652-34885674 TTATGGGGAGGGGGCCTTTCGGG + Intergenic
953631164 3:44619077-44619099 TTTTCACTAGGGGCCCTCTAAGG + Intronic
955564884 3:60233392-60233414 TCTTGGGGAGGAGCCCTCTAAGG - Intronic
957407906 3:79795722-79795744 TTCTGAGGAGGTGACATTTAAGG + Intergenic
960066846 3:113383447-113383469 TTTGGAGGTGGGGCCTTTGAGGG - Intronic
960788950 3:121405152-121405174 ATTTGAAGAGGGAGCCTTTAAGG - Intronic
962137974 3:132757221-132757243 GTTTGATGAGGGGCCTTTAATGG + Intergenic
963365657 3:144331119-144331141 TGTTGAGGAGGGACCCTTACTGG - Intergenic
966086470 3:176073420-176073442 ATTTGAGTAGATGCCCTTTATGG - Intergenic
967805232 3:193709838-193709860 TGTTCAGGAGAGGCCCTTAAGGG + Intergenic
968873658 4:3254124-3254146 TTTTGAGGAGGGGACATTTGGGG + Intronic
969574040 4:8025977-8025999 TTCTGGGGAGGGGCCCTTTCTGG + Intronic
974277174 4:59737599-59737621 TTTTGAGCAGGGGGCCTGTAAGG - Intergenic
974596035 4:64015490-64015512 TTTTGATGAATGACCCTTTAGGG + Intergenic
975993270 4:80283341-80283363 TTCTTAAGAGGAGCCCTTTATGG - Intronic
978350047 4:107811985-107812007 TTCTGAGGAGAGGCCATTCAAGG + Intergenic
978502929 4:109428298-109428320 TATTGAAGAGAGGGCCTTTAAGG + Intergenic
979319763 4:119309840-119309862 TTTTGAGGGGGGTTCTTTTAAGG - Intergenic
980255486 4:130375786-130375808 ATTTGTGGAGGAGCCTTTTAAGG + Intergenic
980725155 4:136749362-136749384 TTTAGATGAGGGGCCCTTTGTGG - Intergenic
981258678 4:142693372-142693394 TTTTAGGGTGGAGCCCTTTAAGG - Intronic
981487750 4:145305037-145305059 CTTTGAGGAGGGAACCTTTGGGG + Intergenic
986984606 5:13485968-13485990 TTTTGAGGAGATGCTCTTTAAGG - Intergenic
989553995 5:42770240-42770262 TTATGTGGAAGGGGCCTTTAAGG - Intronic
991762896 5:69940193-69940215 TTTTGGGGAGGGCCCTTTTGCGG + Intergenic
991784431 5:70177936-70177958 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
991842122 5:70815233-70815255 TTTTGGGGAGGGCCCTTTTGCGG + Intergenic
991876878 5:71178320-71178342 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
995992559 5:118260275-118260297 TTTTGAATAGGGACCCCTTAGGG - Intergenic
996028898 5:118683494-118683516 TCTGGAAGAGGGGCCATTTATGG - Intergenic
998715046 5:144873600-144873622 TTTTGGGTGGGGGCTCTTTAAGG + Intergenic
999768589 5:154757726-154757748 TTTGGAGGAGGGGACATTTGGGG + Intronic
1000466539 5:161585484-161585506 TTTGGAGAAGAGGCTCTTTAGGG - Intronic
1004737973 6:18427265-18427287 TTTAAAGGAGGGGGCCTTTAGGG + Intronic
1009005118 6:57775346-57775368 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
1010863726 6:80946498-80946520 TATTGAGGGCGGGGCCTTTATGG - Intergenic
1013607660 6:111765271-111765293 TTTGGAGAAGGGGGCCTTAAAGG + Intronic
1019685593 7:2380160-2380182 TTTTGAGGTGGTGCCGTTTAGGG + Intronic
1020319465 7:6929415-6929437 ATTTGAGGAGGGAGCCTTAAGGG - Intergenic
1022332078 7:29389572-29389594 TTTTGAGAAGTGTACCTTTAAGG + Intronic
1025209359 7:57011954-57011976 TTTTGATGTGGGTCCCTTAAAGG - Intergenic
1025662586 7:63564900-63564922 TTTTGATGTGGGTCCCTTAAAGG + Intergenic
1028717474 7:93988045-93988067 TTTTTATTAGGGGCCTTTTATGG + Intronic
1031274072 7:119695924-119695946 ATTTGAGGATGGGCCCTCTAAGG + Intergenic
1031714853 7:125096387-125096409 TTTGGAGAAGGGGCCTTTGAAGG - Intergenic
1034224856 7:149474468-149474490 TTTGGAGGCGGGGCTCTTGAAGG + Exonic
1034272205 7:149808816-149808838 TTCTGAGGAGGGGCCCTGTTAGG - Intergenic
1047203980 8:122788917-122788939 TTTTGAGGAGGGGTGGTTTGGGG - Intronic
1053253287 9:36593312-36593334 TTAAGAGGTGGGGCCCTTTAAGG + Intronic
1057469295 9:95343393-95343415 TATTGAGGAGGGGCTCCCTAAGG - Intergenic
1058509238 9:105698356-105698378 TTTTTATGAGGGACACTTTAAGG + Intronic
1058564431 9:106266694-106266716 CTTTGAGGTGGGGCCATTGATGG + Intergenic
1194755000 X:97728522-97728544 TTAGAAGGAGGGGCACTTTAGGG - Intergenic
1195450929 X:105011946-105011968 TTTTGAGGAATGCTCCTTTAAGG - Intronic
1196079031 X:111611275-111611297 TATTGTGTAGGGGACCTTTAGGG + Intergenic
1196765676 X:119240301-119240323 TTTTGAAGAGGGGCCGTATGGGG + Exonic
1199255432 X:145713904-145713926 TGTTGGGGAGGGGAGCTTTATGG - Intergenic