ID: 1104101985

View in Genome Browser
Species Human (GRCh38)
Location 12:125621381-125621403
Sequence CTCTTTGAGTAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104101985 Original CRISPR CTCTTTGAGTAGAGGGAAGG GGG Intronic
900347207 1:2215462-2215484 CCCTCTGAGTAGCGGGAAGGTGG + Intergenic
901874879 1:12161772-12161794 CTCTTTGAGTACTGGGAGAGAGG + Intergenic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902834467 1:19037758-19037780 CTCTTTGAATGGAGGGCTGGAGG - Intergenic
905244871 1:36605814-36605836 CTCTTAGAGGAGTCGGAAGGAGG + Intergenic
905722144 1:40213625-40213647 ATCCTTGAGTAGAAGAAAGGTGG - Intronic
906123108 1:43408194-43408216 CTCTTTGGGTAAAGAGATGGAGG - Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
910212195 1:84804697-84804719 CTGTTTCAGTAGAGTGAAAGGGG - Intergenic
910369096 1:86497038-86497060 CTTTTTGAGTTAGGGGAAGGAGG + Intronic
910987102 1:93016063-93016085 CTCTTTGAGTAGGAAGTAGGCGG + Intergenic
913386398 1:118262403-118262425 TTCTTTGGGTACGGGGAAGGAGG + Intergenic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
915685244 1:157625782-157625804 CTCATGGAGTTGGGGGAAGGAGG + Intergenic
916288052 1:163132511-163132533 CTATTTGAGCTGTGGGAAGGGGG + Intronic
916801433 1:168220106-168220128 CTGTTTCAGTATTGGGAAGGGGG - Intergenic
917776724 1:178345073-178345095 CGGTTTGAGTAGGGGCAAGGAGG - Intronic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918639184 1:186818090-186818112 GACTTTGGGTAGAGGAAAGGGGG + Intergenic
919399534 1:197094555-197094577 GTCTTTGAGCAGACGGGAGGTGG + Intronic
920298161 1:204972402-204972424 TTCTTAGAGTAGGGGAAAGGTGG + Intronic
923938446 1:238791981-238792003 CCCGTTGTGTAGAGGGAAAGAGG + Intergenic
924953293 1:248905711-248905733 TTCTTTGTTGAGAGGGAAGGAGG - Intergenic
1063417853 10:5888994-5889016 CTCTGCGAGTAGAGGGGAGGCGG + Intronic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064650701 10:17506408-17506430 CTCTCTGAGGAGAGGGGATGGGG + Intergenic
1066037901 10:31512227-31512249 CCCTTGGAGTAGAGGGAATATGG - Intronic
1066135639 10:32443089-32443111 GTCTCTGAGTTGAGGGAAGGAGG - Intergenic
1070713390 10:78699949-78699971 CTCTTTGGGGAGAAGGAAGTTGG - Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1072512219 10:96139300-96139322 CAATTTGAGTATGGGGAAGGGGG - Intronic
1072605901 10:96982467-96982489 AGCTTTCAGTGGAGGGAAGGAGG - Exonic
1074139414 10:110658805-110658827 CTAGTTGAGGAGAGGGAAAGAGG - Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076225091 10:128768185-128768207 TTCTTTGAGGGGAGGGAAGCTGG + Intergenic
1076937321 10:133575094-133575116 GTCTGTGAGCACAGGGAAGGAGG + Intergenic
1077342907 11:2033902-2033924 CTCTCTGAGTGGCGGCAAGGTGG + Intergenic
1077463544 11:2722794-2722816 CTGGTGGGGTAGAGGGAAGGAGG - Intronic
1077896997 11:6460528-6460550 GTCTCTGAATGGAGGGAAGGAGG + Intronic
1077904459 11:6519103-6519125 CTATTAGAGGAGAGGGAATGTGG - Intronic
1078493895 11:11796933-11796955 GTCTTTGGGTAGGGGGCAGGGGG - Intergenic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1079504378 11:21137035-21137057 CTCTTACAGAAGAGAGAAGGAGG + Intronic
1083136755 11:60685765-60685787 CAGTTTGAGTTGAGGGTAGGGGG - Intergenic
1084523857 11:69684010-69684032 CTGTTTGTGTCGAGGAAAGGGGG + Intergenic
1084529102 11:69716737-69716759 CTCCTTCAGTAGAGGGGAGAAGG + Intergenic
1084547848 11:69823259-69823281 CTCTCTGGGTAGAGGAGAGGAGG + Intergenic
1084783953 11:71430774-71430796 CTCATTCAGTAGAGGGGAGACGG - Intronic
1086521986 11:87679234-87679256 CTCTTAGAGTAGAAGAAAGGGGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1088779507 11:113120826-113120848 TTCATTGGGGAGAGGGAAGGAGG + Intronic
1090661649 11:128886514-128886536 CTCTTTGAGCAGGTGGAGGGTGG + Intergenic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1090903565 11:131053717-131053739 CTCTTGGTATTGAGGGAAGGTGG - Intergenic
1202825893 11_KI270721v1_random:89091-89113 CTCTCTGAGTGGCGGCAAGGTGG + Intergenic
1093794448 12:23294659-23294681 TACTTTGATTACAGGGAAGGAGG - Intergenic
1094204244 12:27823924-27823946 ATCTTTCAGTTGAGAGAAGGAGG - Intergenic
1095295111 12:40518670-40518692 TTCTCTGAGCACAGGGAAGGTGG - Intronic
1095334979 12:41013010-41013032 CTCTTTCTGTAGAGGGAGAGGGG + Intronic
1096098684 12:48956098-48956120 CTGATTGAGGACAGGGAAGGAGG + Intronic
1098042830 12:66369643-66369665 CTCTTTGGGGTGAAGGAAGGTGG + Intronic
1098692797 12:73510310-73510332 CACTATGAAAAGAGGGAAGGTGG + Intergenic
1098952125 12:76650882-76650904 CTCTTTGAGTAAATTGAAGTTGG - Intergenic
1099614355 12:84915425-84915447 CTCTTTGACTAGAGGAGAGAAGG + Intergenic
1102514458 12:113437011-113437033 CACGTCGAGTAGATGGAAGGGGG + Intronic
1103629022 12:122244344-122244366 CTTTTTGTGTGGAGGGTAGGTGG - Intronic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1106087834 13:26558421-26558443 CTCTTGGAGTGCAGGGGAGGAGG + Intronic
1106196668 13:27499823-27499845 CTCTCTGAGTAGACAGAAAGGGG + Intergenic
1106407185 13:29484346-29484368 CTATTTGATTAGAGAGAATGTGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107258777 13:38464951-38464973 CTCTTTCAGTAAAGAGAAGAAGG - Intergenic
1108288106 13:48928683-48928705 CACTTTGAAAAGGGGGAAGGAGG + Intergenic
1110078996 13:71287078-71287100 CTCCTCAAGTAGAAGGAAGGTGG + Intergenic
1110511033 13:76350567-76350589 TTCTTGGAGTGGCGGGAAGGGGG + Intergenic
1110846385 13:80194752-80194774 CTCTCTGATTAAAGGGAACGAGG - Intergenic
1111448673 13:88385442-88385464 CTCCTTGAGTAGAGTGAATTTGG + Intergenic
1112217391 13:97447338-97447360 CCCTGTGGGTAGAGTGAAGGGGG - Intronic
1113296153 13:108960889-108960911 ATCTTTGAGCAGAGGGTAGCAGG - Intronic
1116628148 14:47293423-47293445 GACTTTGAGTAGAGGTAATGTGG - Intronic
1117127034 14:52640270-52640292 CTCCTTGAGTGGAGCAAAGGAGG + Exonic
1119438726 14:74613859-74613881 ACCTTCCAGTAGAGGGAAGGGGG - Intergenic
1120240746 14:81947084-81947106 CCCTTTAAGTAAAGGGGAGGGGG - Intergenic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1122239061 14:100349802-100349824 CTCTTTGAGTGGGAGGGAGGTGG - Intronic
1122645622 14:103191521-103191543 CTCTTGGCCTCGAGGGAAGGCGG + Intergenic
1124146977 15:27136939-27136961 CTCTTGGAGAAGAGGCAAGTGGG - Intronic
1124719403 15:32098445-32098467 CTCTTTGAGAAGGGGGAAAGGGG + Intronic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1128292259 15:66486919-66486941 CTCTCTCAATAGAAGGAAGGGGG + Intronic
1129503931 15:76065308-76065330 CTGTTTCAGTAGAGGGGTGGGGG - Intronic
1130240052 15:82179682-82179704 TTCTTTCAGTGGAGGGAGGGAGG - Intronic
1131075938 15:89494987-89495009 CCCCTTGAGGAGAGGAAAGGTGG + Intronic
1131962263 15:97802022-97802044 CACTTTGAGTAGAAGGAGGAAGG + Intergenic
1132180339 15:99748150-99748172 CTACTTGAGGAGTGGGAAGGAGG + Intergenic
1133576239 16:7093583-7093605 CTCGTTGATTAGAGGGAAACTGG + Intronic
1136565789 16:31069363-31069385 CTCTTTGAGGAGAAGAAAGGAGG - Intronic
1141223392 16:82092264-82092286 CTCTTGGGGTGGAGGGGAGGTGG - Intronic
1142733582 17:1879932-1879954 CTCCTGGAGTTGAGGGAGGGAGG + Intronic
1142979099 17:3661377-3661399 AGCTTTGGGCAGAGGGAAGGAGG - Exonic
1143500455 17:7335755-7335777 GTCGTTGAGGAGAGGGGAGGAGG + Intergenic
1143642657 17:8207943-8207965 CTCTTTGAATTGGGGGTAGGTGG - Intronic
1144951833 17:18998543-18998565 CTCTTGGGGTTGTGGGAAGGAGG + Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146963337 17:37003775-37003797 CTCTTTTAGTAGAGTGGTGGAGG + Intronic
1147010074 17:37438826-37438848 TTCTTTGTTAAGAGGGAAGGAGG - Intronic
1149179092 17:53912706-53912728 CACTTTGACTAGAGGGATGGGGG - Intergenic
1149448996 17:56734868-56734890 CTCTTTGAGAAGCAGGATGGAGG + Intergenic
1149493942 17:57105309-57105331 CTCTTGGAGGGCAGGGAAGGCGG + Intronic
1149596582 17:57868001-57868023 CTCATGGAGGAGAGGGGAGGAGG + Intronic
1150848606 17:68683765-68683787 CTCATTGTGTAGAGGCAATGGGG + Intergenic
1151350065 17:73526404-73526426 CTCTTTGAGGAGAAAGAAGGGGG + Intronic
1152993505 18:384561-384583 CTCTTTGAGCAGGGAGTAGGAGG + Intronic
1154484868 18:14865515-14865537 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1155218568 18:23664020-23664042 TTAATTGAGAAGAGGGAAGGAGG - Intergenic
1156274701 18:35573431-35573453 ATCTTAGAGTAGAGAAAAGGTGG + Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1159091394 18:63853117-63853139 CTATTTTAGTAAAGGGAATGTGG - Intergenic
1159092085 18:63860908-63860930 CTCCTCAAGCAGAGGGAAGGAGG + Intergenic
1159708548 18:71724309-71724331 ATCTTTAAAGAGAGGGAAGGTGG - Intergenic
1159812966 18:73038990-73039012 CTCTGGGAGAAGAGGGATGGGGG - Intergenic
1160880016 19:1315479-1315501 CGCTGTGAGGTGAGGGAAGGAGG + Intergenic
1162964388 19:14149118-14149140 CCCCTAGAGTTGAGGGAAGGGGG + Exonic
1163407110 19:17129595-17129617 CTCTTGGACTTGAGGGAGGGCGG + Intronic
1164580667 19:29433099-29433121 CTCTTTGGAGAGAGGGATGGGGG - Intergenic
1165127837 19:33613250-33613272 CTCTCTGAGGACAGGGACGGGGG + Intergenic
1166082368 19:40452065-40452087 CTCCTTGGGAGGAGGGAAGGAGG - Intronic
1166752686 19:45172220-45172242 CTCCTTGAGGACAGGGATGGTGG - Intronic
1166752953 19:45173412-45173434 CTCCTTGAGGACAGGGATGGTGG - Intronic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
927054982 2:19358992-19359014 CTCTTTGGGAGGAGGGAGGGAGG + Intergenic
928165132 2:28965717-28965739 CTCTTAGAGAAGAGGGAGGTAGG - Intronic
929891701 2:45923793-45923815 TTCTAGGAGCAGAGGGAAGGAGG + Intronic
931228917 2:60357401-60357423 GGCTTGGAGTTGAGGGAAGGCGG + Intergenic
931254153 2:60555472-60555494 CGCTCCGAGGAGAGGGAAGGAGG - Intergenic
931485264 2:62684294-62684316 CTTTCTGAGTGGAGGGATGGGGG + Intronic
932363643 2:71131020-71131042 GTCTGTGTGTAGAGGGATGGGGG - Intronic
932874184 2:75433282-75433304 CTCTTGGGGTAGAGGAAGGGTGG + Intergenic
933089517 2:78103807-78103829 CTCTTAGTGAAGAGGGAATGTGG - Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
938914225 2:135918559-135918581 CTTTTTCAGTAGAGTTAAGGTGG - Intronic
941603968 2:167572946-167572968 CTCTTTGAATTGGGGTAAGGAGG - Intergenic
941710876 2:168712000-168712022 CTCTCTGAGTTGTGGAAAGGTGG + Intronic
941768465 2:169325358-169325380 TTCTTTGAGTTCAGTGAAGGTGG - Intronic
942074842 2:172348020-172348042 CTCTCTGAGTAGAGGAAACTGGG - Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947936585 2:234009727-234009749 CTCTGTGAGTAAAAAGAAGGAGG - Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1169689999 20:8319842-8319864 CTCTTGGGGTGGGGGGAAGGGGG + Intronic
1170569540 20:17625106-17625128 CTCTGTGAGAAGGGGGCAGGAGG + Intronic
1172632312 20:36386581-36386603 CTTTTTGGGTTGGGGGAAGGGGG + Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174719551 20:52797375-52797397 CTCTATGAAGAGTGGGAAGGAGG + Intergenic
1175980314 20:62735427-62735449 GGCTTTGAGGAAAGGGAAGGAGG - Intronic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
1176723625 21:10412868-10412890 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1176796460 21:13373960-13373982 GTTTTTGGGTAGATGGAAGGGGG + Intergenic
1180304781 22:11065643-11065665 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1185089342 22:48757124-48757146 CTCTTTGGAGAGAGGCAAGGAGG + Intronic
949280518 3:2341581-2341603 CTCTTTGAGTAGAGTCCAAGGGG - Intronic
949926457 3:9046112-9046134 CTCATTGACTAGGGGGTAGGAGG - Intronic
954681720 3:52349637-52349659 CTCTAAGAGTCTAGGGAAGGAGG - Intronic
955412012 3:58661853-58661875 CTCCTTGAGAAGGGGGATGGAGG - Intronic
955596009 3:60591317-60591339 ATTTTTGAGTAAAGAGAAGGTGG - Intronic
955871536 3:63443404-63443426 TTCTTTCAGGAGAGGGAAGTTGG + Intronic
956271646 3:67454192-67454214 CTCTTTAAGTACAGGGACGAGGG + Intronic
959279198 3:104316640-104316662 CTCTTCAAGTGGAAGGAAGGGGG - Intergenic
963142704 3:141960943-141960965 TCCTTTGAGTGGAGGGAAGGAGG - Intronic
964830796 3:160882086-160882108 ATCTTTGAATAAAGTGAAGGAGG + Intronic
966175718 3:177136006-177136028 CTATTGGAGTAAAGGGAAGATGG - Intronic
967035120 3:185643283-185643305 CTTTTTAAGTGGAGGAAAGGGGG - Intergenic
967099417 3:186203943-186203965 CTCTTAAACTAGAGGGAAAGAGG - Intronic
967229660 3:187325434-187325456 GTCTTTGAGTAGTTGAAAGGGGG + Intergenic
969122195 4:4918892-4918914 CTCTGTGAGCAGAGAGACGGGGG + Intergenic
969480807 4:7445887-7445909 CCCTGAGAGTAGAGGGATGGGGG + Intronic
969843954 4:9904908-9904930 CTCTTTGAGAAGATGAAAGGGGG + Intronic
970195026 4:13544233-13544255 CTCTTTGGGGAGAGGGACGCGGG - Exonic
971083058 4:23237838-23237860 CTCTTTGAGATGAGGGATGGTGG - Intergenic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
978264027 4:106800682-106800704 CTTGTTGAGTAGAGGCATGGAGG + Intergenic
979361818 4:119774116-119774138 CTCCTTGGAGAGAGGGAAGGGGG + Intergenic
980504594 4:133699924-133699946 CTCTTTAAATAGAGGGAAGGAGG - Intergenic
981020858 4:140026650-140026672 GTCTTTGTGTAGGGGGAAAGAGG - Intronic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
981833719 4:149030609-149030631 CACTTTGGATAGATGGAAGGAGG + Intergenic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
985063981 4:186104460-186104482 CTCTCTGACGATAGGGAAGGTGG - Intronic
985374865 4:189324241-189324263 TTCTTTGAGAAGAGTAAAGGTGG - Intergenic
985553698 5:545916-545938 CTCTTTGTGGAGGGGGAAGAGGG + Intergenic
986164839 5:5264568-5264590 CTCTCTCAGTAAAGAGAAGGAGG + Intronic
986367930 5:7053525-7053547 CTCTTTGGGTGGGGGGTAGGGGG + Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988679983 5:33475524-33475546 CTCATTTACTGGAGGGAAGGAGG - Intergenic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
991715754 5:69449528-69449550 CCCTTTGTGTATAGGGCAGGAGG + Intergenic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992454303 5:76902120-76902142 CTCTTCAAGCAGAAGGAAGGGGG + Intronic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995965120 5:117896689-117896711 CTCTTTCAGAAGAGAGAAGCAGG + Intergenic
996093108 5:119370348-119370370 CTCTTTAAGTTGAGTAAAGGAGG + Intronic
996117335 5:119633201-119633223 CTCCTTGGGTAGGGGGCAGGAGG + Intronic
999288281 5:150407093-150407115 GTCTCTGAGTTGAGGGATGGTGG + Intronic
1000234309 5:159343417-159343439 TTATTTGAATAGAGGAAAGGAGG + Intergenic
1000857153 5:166412788-166412810 TTTTCTGAGAAGAGGGAAGGTGG + Intergenic
1000904959 5:166954197-166954219 CTCTTTGAGGATTAGGAAGGCGG - Intergenic
1001333191 5:170776851-170776873 TTATTTGAGTTGAGGGAACGTGG + Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1001980997 5:176037001-176037023 GTTTTTGGGTAGATGGAAGGGGG + Intergenic
1002236464 5:177807065-177807087 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1002723574 5:181280821-181280843 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1003924884 6:10868480-10868502 CTCTTTCAAAAGAGAGAAGGAGG - Intronic
1004484958 6:16057711-16057733 CTGTTTGACGAGATGGAAGGAGG - Intergenic
1006645752 6:35512941-35512963 CTCCTTGAGCAGGGGGAAGGGGG - Intergenic
1007881466 6:45172457-45172479 CTCTTTGAATCCAGGGAATGCGG + Intronic
1010376821 6:75180338-75180360 TTCCAGGAGTAGAGGGAAGGAGG + Intronic
1014946935 6:127510094-127510116 CGATTTGAGAAGATGGAAGGTGG - Intronic
1014975180 6:127871904-127871926 CTCTTTCAGAACATGGAAGGGGG + Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1017076423 6:150622953-150622975 CTATTAGAGAAGAGGGGAGGCGG + Intronic
1017195784 6:151698569-151698591 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1017201943 6:151763981-151764003 CCCTGTGGGTAAAGGGAAGGAGG + Intronic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1022142864 7:27508379-27508401 CTCTTTGAAGAGAGGTAAGGGGG + Intergenic
1022147119 7:27555564-27555586 CTATTTGAGGAGAGGGTAGGGGG - Intronic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1023754962 7:43407798-43407820 CTCCATGAATGGAGGGAAGGAGG - Intronic
1026849624 7:73716814-73716836 GTCTCTGAGTTGAGGGGAGGAGG + Intronic
1027374692 7:77537735-77537757 CTCTGTGAGGAGAGGGGCGGAGG + Intronic
1027673678 7:81133078-81133100 GTCCTTGAGTCTAGGGAAGGAGG - Intergenic
1028754453 7:94419597-94419619 CTCTTTGGGACTAGGGAAGGCGG - Intronic
1030609201 7:111670288-111670310 ATCTTTGAGTTAAGGGAGGGAGG + Intergenic
1032056010 7:128684822-128684844 ATCTTTGAGTATTGGGAATGGGG + Intronic
1032135933 7:129277688-129277710 CTCTTTGGGGAGAGGGGAGTGGG + Intronic
1032589046 7:133175438-133175460 CTCTTTGGGTAGAGGGTGGTGGG - Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033548336 7:142422791-142422813 GTCTTTGAGTACAGGCCAGGTGG - Intergenic
1033555990 7:142488857-142488879 CTCTTTGATGGGAAGGAAGGAGG - Intergenic
1034422750 7:150997951-150997973 CTCTTTGAGCACATGGATGGTGG - Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1035110346 7:156476348-156476370 CTTTTGGAGGAGAAGGAAGGTGG - Intergenic
1035341491 7:158165418-158165440 CTCTTGGAGGAGAAGGACGGCGG - Intronic
1035395432 7:158531774-158531796 TTCTATGAGCAGAGGGCAGGTGG - Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1037742317 8:21617394-21617416 CTCTATAGGTAGAGGGCAGGTGG - Intergenic
1039006873 8:33048792-33048814 CTCTTTGAGAAAATAGAAGGGGG + Intergenic
1039256105 8:35720566-35720588 TTAATTGAGTAGAGGGAAGGTGG + Intronic
1041816832 8:61982599-61982621 CTCGATGAGAAGAGGGAATGTGG + Intergenic
1043270318 8:78325091-78325113 ATATTTGAGTATAGGGATGGTGG + Intergenic
1045603013 8:103739375-103739397 GTCGTAGGGTAGAGGGAAGGGGG + Intronic
1048310718 8:133320601-133320623 CCCTTTGAGTAGAGGCAGTGTGG - Intergenic
1048815966 8:138333916-138333938 CTCTTTTATTTGAGGGGAGGGGG + Intronic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1051431889 9:16987788-16987810 TTCTGTGAGTAGAAGGAATGTGG + Intergenic
1051769883 9:20565884-20565906 TTCCTTGAGTAGGAGGAAGGAGG - Intronic
1052026441 9:23578104-23578126 CTTTTGGAGGAGAGGGGAGGTGG - Intergenic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1053885777 9:42644371-42644393 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1054224795 9:62451820-62451842 GTTTTTGGGTAGATGGAAGGGGG - Intergenic
1055399545 9:75908482-75908504 CTTTTTGACCAGAGGAAAGGGGG - Intronic
1056764302 9:89435504-89435526 CTCTGTGAGTTGGGGAAAGGAGG - Intronic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1059165751 9:112075026-112075048 TTTTTTGAGTAAAGGGGAGGGGG - Intronic
1059210193 9:112507090-112507112 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1059787749 9:117604844-117604866 TTGTTTGCGTAGAGGTAAGGTGG - Intergenic
1060070748 9:120544861-120544883 CTCTTGGAGTAGAAGGGTGGAGG + Intronic
1061398282 9:130355125-130355147 CTCCTGGAGTGGAGGGAGGGTGG + Intronic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061701950 9:132422777-132422799 CACCTTCAGTAGAGGGAAGGAGG - Intronic
1061947390 9:133916382-133916404 CTCTTTGTAGAAAGGGAAGGTGG + Intronic
1187765776 X:22640229-22640251 CTCACTGAGTATAGGGCAGGAGG - Intergenic
1190141450 X:47849310-47849332 CTCTGGGAGTAGAGGGATTGTGG - Intronic
1195001442 X:100647072-100647094 CTCAGTGAGAAGAGGGAAAGGGG + Intronic
1195996543 X:110737411-110737433 CACTTTGAGTAGAGGGTTGGTGG - Intronic
1196409796 X:115405934-115405956 CTCTATGAGCAGAGAGAAAGAGG - Intergenic
1197918387 X:131561006-131561028 CCCTTTGCATGGAGGGAAGGTGG - Intergenic
1198379608 X:136071486-136071508 CTATTTCAGAAGAGGTAAGGGGG + Intergenic
1201347216 Y:12998515-12998537 CCCTTTGGGGAGTGGGAAGGCGG + Intergenic