ID: 1104103758

View in Genome Browser
Species Human (GRCh38)
Location 12:125639969-125639991
Sequence CGGCTCCTCTAGGCCATCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104103754_1104103758 -5 Left 1104103754 12:125639951-125639973 CCAGGTGGGCTGGTCCAGCGGCT 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1104103742_1104103758 24 Left 1104103742 12:125639922-125639944 CCTGATAAAACGCCTCAAAGTCG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
1104103749_1104103758 12 Left 1104103749 12:125639934-125639956 CCTCAAAGTCGGGGGGTCCAGGT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104103758 Original CRISPR CGGCTCCTCTAGGCCATCGA GGG Intronic
916660158 1:166916042-166916064 CTGCTTCTCTAGGCCATGCATGG - Exonic
1070328279 10:75401613-75401635 CGGCTCCTCTAGCCCGGCCACGG - Exonic
1073199923 10:101727059-101727081 CGGCTCCTCCACCCCATCCAAGG - Intergenic
1075645096 10:124092032-124092054 CGACTCCTCCAGGCAACCGATGG - Intronic
1077495581 11:2885094-2885116 CGCCTCCTCGAGGCCGTCGAGGG + Exonic
1078096100 11:8298215-8298237 CGGCACCTCTGGGACATCCAAGG + Intergenic
1084363608 11:68684392-68684414 CGGGTCCTCTGGGCCATCATAGG - Intronic
1085037756 11:73309958-73309980 AGGCACCTCTAGGGCATTGAGGG + Exonic
1088606793 11:111540727-111540749 CAGCATCTCTAGGCCACCGACGG - Exonic
1089138504 11:116268289-116268311 CGCCTCCTCCAGGCCCTTGAGGG + Intergenic
1097958720 12:65512112-65512134 GGGCTGCTCCAGGCCATTGATGG + Intergenic
1102075626 12:110057523-110057545 CTGGTCCTCTAGGCCATGGTGGG + Intronic
1104103758 12:125639969-125639991 CGGCTCCTCTAGGCCATCGAGGG + Intronic
1106380765 13:29236690-29236712 CAGCTCGTCTAGGCCATGGAAGG + Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108525266 13:51280820-51280842 GGCCCCCTCTAGGTCATCGATGG - Exonic
1119095336 14:71824730-71824752 CTGCTCTTCAAGACCATCGAGGG - Intergenic
1122603675 14:102933727-102933749 CGGCTGCTCCAGGCCTTCGAGGG + Exonic
1124109611 15:26773404-26773426 CGGCTCCTCTGGGCTCTCGGCGG + Intronic
1128111346 15:65078046-65078068 ACGCTGCTCTACGCCATCGAGGG + Exonic
1132205610 15:99984202-99984224 CGGCCCCTGCAGGCCATCGGGGG - Intronic
1155345232 18:24850958-24850980 AGGCTCCTCTAGGGCAAAGAAGG + Intergenic
1160104839 18:75964172-75964194 AGGCTTTTCTAGGCCATCGGTGG - Intergenic
1162256929 19:9498346-9498368 CGGCTCCTCTAGGGGACCGAAGG + Intronic
1167504207 19:49862728-49862750 CGTCTCCCGTAGGCCAACGACGG - Exonic
925906674 2:8543970-8543992 GGGCACCTCAGGGCCATCGAAGG + Intergenic
927014825 2:18948582-18948604 AGGCTCCTGTAGGCCACCTAAGG + Intergenic
934752473 2:96802330-96802352 CGTCTCCTCTTGGCCGTGGAGGG - Intronic
937361877 2:121235224-121235246 CGGCTCTTCAACGCCATCAAAGG - Exonic
1170882626 20:20310595-20310617 CTGCTCCTCCAGCCCATTGAAGG - Intronic
1180060994 21:45385027-45385049 GGGCTCCTCCAGGCCACTGAAGG - Intergenic
1185389132 22:50549379-50549401 GGGCTGCTCTATGCCATCGGTGG + Exonic
950755504 3:15167718-15167740 CGGCTCCTCTTGACAATCCAAGG - Intergenic
953969575 3:47336642-47336664 GGGCTTCTCTATGCCATCGGAGG + Exonic
963263113 3:143212641-143212663 CGGCTCCTGTAAGCCAGTGATGG - Intergenic
966880416 3:184346781-184346803 CAGCTCCGGAAGGCCATCGAGGG - Exonic
967377931 3:188826519-188826541 TTGCTACTCTAGGCCATCCATGG + Intronic
971694658 4:29884746-29884768 CGACTCTTCTAGGCCACCCATGG - Intergenic
975446102 4:74467482-74467504 AGGCTACTCTAGGCTTTCGATGG - Intergenic
978954835 4:114599752-114599774 CCGCTCCTCCAGTCCATGGAAGG - Intronic
981034200 4:140153080-140153102 CGGCTCCGCCAGCGCATCGAGGG - Exonic
984839651 4:184056642-184056664 CAGATCCTGTAGGCCATCGGTGG + Intergenic
985530070 5:429011-429033 TGGCTCCTAGAGGCCATGGACGG + Intronic
1000641585 5:163709282-163709304 CGTCTCTTCTAGGTCATCGGTGG + Intergenic
1001412224 5:171519828-171519850 GGGCTCCCCAAGGCCATGGAAGG + Intergenic
1001644875 5:173272914-173272936 CGGCTCCACTAAGACATCTAGGG + Intergenic
1010064977 6:71672024-71672046 CCTCTCCTCTAGGACATCAACGG - Intergenic
1022443598 7:30452550-30452572 CAGCTCGTCCAGGCCATCGAAGG + Exonic
1026906082 7:74063481-74063503 TGGCTCCACTGTGCCATCGAAGG + Intronic
1036148244 8:6274776-6274798 TGGCTGGTCTAGGCCACCGAGGG + Intergenic
1041724390 8:61004684-61004706 CGGCTCCTCCAGGCCCGCGCAGG - Intergenic
1042514321 8:69643948-69643970 GAGCTCCTCTTGGCCATCAAAGG - Intronic
1042556120 8:70035007-70035029 CAGCCCCTCTAGACCCTCGAGGG + Intergenic
1045114922 8:98972323-98972345 CTGCTCCTCTAGGGCTTGGAGGG + Intergenic
1058681387 9:107443379-107443401 TGGCTCCTCTGGGCCTTGGATGG + Intergenic
1203771859 EBV:53660-53682 CAGCTCCTCCATGCCATCCATGG + Intergenic
1195520439 X:105822831-105822853 CGGCTCCTCGAAGCCATGGCGGG + Exonic
1199296937 X:146170178-146170200 CAGCTCCTAAAGGCCATCTACGG - Intergenic
1199679372 X:150214811-150214833 CCGCTCCTCTTGGCCCTCTATGG + Intergenic
1199695855 X:150342238-150342260 CCGCTCCTCTTGGCCCTCTATGG - Intergenic
1200309572 X:155064293-155064315 CGGCTCCTCTAGCCTAACGTTGG - Exonic
1200339154 X:155381425-155381447 CGGCTCCTCTGTGCCATCCCTGG - Intergenic
1200347315 X:155459267-155459289 CGGCTCCTCTGTGCCATCCCTGG + Intergenic