ID: 1104104155

View in Genome Browser
Species Human (GRCh38)
Location 12:125643182-125643204
Sequence TGTGGTGGCCCCACTGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104104147_1104104155 5 Left 1104104147 12:125643154-125643176 CCCAGTTTCTGGCTTGCAAAAGT 0: 1
1: 0
2: 3
3: 33
4: 317
Right 1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG 0: 1
1: 0
2: 5
3: 24
4: 150
1104104148_1104104155 4 Left 1104104148 12:125643155-125643177 CCAGTTTCTGGCTTGCAAAAGTG 0: 1
1: 1
2: 0
3: 30
4: 194
Right 1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG 0: 1
1: 0
2: 5
3: 24
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104104155 Original CRISPR TGTGGTGGCCCCACTGGTTG AGG Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
902612805 1:17607182-17607204 TGTGGTGGCTCGGCTGGGTGTGG + Intronic
904102799 1:28047103-28047125 TGTGGTGGCTCCACTTTTGGAGG - Intronic
905845764 1:41230164-41230186 TGTGGTGACCGCATTGGTGGAGG + Intronic
905890331 1:41514930-41514952 AGAGGTGACCCGACTGGTTGGGG - Intronic
906431936 1:45762094-45762116 TGTGGTGGCCCCAGGAGTGGAGG - Intergenic
907145261 1:52225262-52225284 TGTGGTGGCCCCAGGAGTGGAGG - Intronic
911266657 1:95752606-95752628 TGGGGAGGCACCACTGGTGGTGG + Intergenic
912520372 1:110240760-110240782 TGTGGTGGCAGCCCTGGTGGTGG - Intronic
913009508 1:114669732-114669754 TCTCGTGGCCGCACGGGTTGTGG - Intronic
915213043 1:154324309-154324331 TGTGGTGGCCCCTCTGGTGGGGG + Exonic
916642299 1:166743472-166743494 TGTGGTGACCCCAAAGGATGTGG - Intergenic
917015585 1:170528217-170528239 TGTGAGGGACCCCCTGGTTGTGG - Intergenic
920806239 1:209236666-209236688 TGTGATGGCCCAACTAGTTTAGG + Intergenic
921054620 1:211534545-211534567 GGTGGAGGCACCACTGGCTGGGG + Intergenic
921058823 1:211565321-211565343 TGTGGTGCCCCCATTGATTGGGG + Intergenic
921409865 1:214823841-214823863 TGTGCGGACTCCACTGGTTGGGG - Intergenic
921758047 1:218882044-218882066 TGTGCTGGGCCCACAGGGTGAGG - Intergenic
1062799794 10:370462-370484 TGGGGTGGGCACACTGGGTGGGG - Intronic
1064075971 10:12269043-12269065 TGAGGGGGCCCCACAGGTGGGGG + Intergenic
1067077409 10:43196146-43196168 TGAGGAGGCCTCACTGGTTGGGG - Exonic
1067497428 10:46773471-46773493 TGTGCTGGCTCCACTGGGCGGGG - Intergenic
1067597224 10:47566944-47566966 TGTGCTGGCTCCACTGGGCGGGG + Intergenic
1068648619 10:59497168-59497190 TGTGTTGGCCCCACTGCTGGAGG + Intergenic
1069092902 10:64223581-64223603 TGTGGAGGCCCCATTGCTGGAGG - Intergenic
1069707392 10:70467388-70467410 TCTGGTGGTCCCAGTGGTGGAGG + Intergenic
1070140573 10:73734554-73734576 TGTGCTGGCTCCACTGGGCGGGG + Intergenic
1070510679 10:77157944-77157966 TCTGGTGCCCCCATGGGTTGGGG + Intronic
1070663550 10:78327857-78327879 TGTGGTGGCAGCAGTGGTGGAGG + Intergenic
1075705246 10:124496749-124496771 TGCGCTCGCCCCACTGGGTGTGG + Intronic
1077061259 11:618846-618868 TGCTGTGCCCCCACTGGGTGTGG + Exonic
1077112263 11:867000-867022 GGAGGTGGCCCCACTGGTCCTGG + Exonic
1082782379 11:57297849-57297871 ACTGGTGGCCCCACTGGTCTGGG - Intergenic
1083828780 11:65217886-65217908 AGTGGTGGCCCTGCTGGCTGTGG + Intergenic
1084088704 11:66866425-66866447 TGTGGACGCCCCACTGGCTGCGG - Intronic
1092132846 12:6124583-6124605 TGTGGAGTCCCCACTGCTGGGGG + Exonic
1093137968 12:15474435-15474457 TTAGCTGGCCCCACTGGTTATGG + Intronic
1100273903 12:93053284-93053306 TGTGTTGGCCAGACTGGTTTTGG - Intergenic
1100671033 12:96813240-96813262 TGTGATGGCCTCAGTGGCTGGGG - Intronic
1101051512 12:100868646-100868668 TGTGGTGGCTGCCCTGGGTGTGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1105616930 13:22027575-22027597 TGAGGTGGCCCCACCGTTTCAGG + Intergenic
1107031997 13:35862630-35862652 GGTGGTAGCCCCGTTGGTTGTGG - Intronic
1109211225 13:59538114-59538136 TGTGGGCTCCCCTCTGGTTGAGG + Intergenic
1110470361 13:75853301-75853323 TGTGGTGGCCACACCTGTGGTGG - Exonic
1111377447 13:87399232-87399254 TTTGGTGGGCACACAGGTTGGGG - Intergenic
1112815035 13:103263560-103263582 TGTGATGACTCCACTGCTTGTGG + Intergenic
1117415834 14:55494706-55494728 TGAACTGGCCCCACTGGATGTGG + Intergenic
1119383387 14:74242241-74242263 TGTGGCGGCCCCACCTGATGGGG - Intronic
1119400361 14:74358541-74358563 TGTGATGGCCCCACCTGTGGGGG + Exonic
1119898839 14:78243192-78243214 GGTAGCGGGCCCACTGGTTGGGG - Intronic
1121614214 14:95301970-95301992 TGTGGTGGCCCAACTGAATGAGG - Intronic
1125973732 15:43933218-43933240 AGTGGTTGTCCCACTGGTGGAGG + Intronic
1126252780 15:46588313-46588335 TGTGGTGGTCCTACTGCTGGGGG + Intergenic
1126375172 15:47990392-47990414 TCTGGTGGCACTACTGGGTGTGG - Intergenic
1127410086 15:58697199-58697221 TGTAGTAGCTCCACTGCTTGGGG - Intronic
1128616394 15:69113919-69113941 TGTGGTGGCCACAGTGGTCTGGG + Intergenic
1129158466 15:73733268-73733290 TGTGCTCGCCCCTCTGGTAGGGG + Intergenic
1130032291 15:80326970-80326992 TCTGGAGGCCCCACGGGTTTGGG + Intergenic
1130306474 15:82715062-82715084 TGGGTTGACCCCACTGGTTGGGG - Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136476693 16:30517928-30517950 TGTGGGGGCCCCAATGCCTGGGG + Intronic
1141204702 16:81924837-81924859 TGTGGTTGCCCAACTGGGTCTGG - Intronic
1143762794 17:9117029-9117051 TGGGATGGCCCCACTGGGCGGGG + Intronic
1151513595 17:74578069-74578091 TGGGGTGTCCACACTGGGTGGGG + Intergenic
1151923384 17:77174628-77174650 TGTGGTGGCCTCAAGGGTTAGGG - Intronic
1153014508 18:571434-571456 TGAGGTGGGCAAACTGGTTGAGG + Intergenic
1153695583 18:7637477-7637499 TGAGGTGGCCCCAATGCTAGTGG - Intronic
1161270462 19:3386858-3386880 TGTGAGGGCCCCACAGGCTGAGG + Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1163632344 19:18423944-18423966 TCTGGGGGCGCCACCGGTTGGGG - Intronic
1165411857 19:35666857-35666879 TGTGGTGGGCCTGCTAGTTGTGG + Exonic
1165767485 19:38360392-38360414 TGTGGTGGCCCCATTGTTTGAGG - Intronic
1166956100 19:46465905-46465927 TGTAGTGGCCACCCTGGTTCAGG + Intergenic
925212412 2:2061266-2061288 TGTGGGGGCCGCAGTGGCTGAGG + Intronic
926998888 2:18771243-18771265 TGTGTTGCCATCACTGGTTGAGG - Intergenic
929747238 2:44671573-44671595 TGGGGTGGCCACACGGGGTGAGG - Intronic
929884068 2:45862999-45863021 TGCTGTGGCCCCACTGCTGGAGG + Intronic
930198494 2:48530785-48530807 TGTGGTGGCCCCCGCGGCTGTGG - Exonic
940246805 2:151627792-151627814 TGTGGTGGCCGAGCTGCTTGCGG + Exonic
947613133 2:231536181-231536203 TGTGGATGACCCACTGGGTGGGG - Intergenic
948339644 2:237239215-237239237 TGTGATGGTCCCAGGGGTTGGGG + Intergenic
948513660 2:238489449-238489471 TGGGGTGGCCCGGCAGGTTGAGG - Intergenic
1169207886 20:3750180-3750202 CGTTGTGGCCCCGCTGCTTGCGG - Exonic
1169968000 20:11238556-11238578 TGTGGTGCTCACAATGGTTGTGG - Intergenic
1171504413 20:25622178-25622200 TGTGGAGGACACACTGGATGTGG + Intronic
1173496973 20:43526588-43526610 TGTTGTGGCCCAACTGGATCAGG + Intronic
1179935903 21:44603152-44603174 TGTGGTGGCCACAGAGGCTGTGG + Intronic
1180207679 21:46272018-46272040 TGTGGTGGACCCTCTGCTTGTGG - Intronic
1180883964 22:19226519-19226541 TGTGGTGGCAGCAGTGCTTGTGG + Intronic
1180932965 22:19605944-19605966 TGTGGTGGCCCCACAGGCAGCGG + Intergenic
1185247623 22:49781470-49781492 TGTGGTGTCCACATGGGTTGGGG - Intronic
956222539 3:66919765-66919787 TGTGGTGGGGTCACTGGGTGGGG + Intergenic
960333577 3:116391500-116391522 TGTGGTGGCCCCCAGGGTGGTGG - Intronic
962271498 3:133980892-133980914 TGGGGTGGCCACACAGGTTCAGG - Intronic
965793320 3:172411780-172411802 TGTGGTGGCCCCTAGGGTGGCGG + Intergenic
967421315 3:189276236-189276258 GGTGGTGGCCCCCATGGATGTGG + Intronic
970710747 4:18859451-18859473 TGTGGTGGTCCTCCTGCTTGAGG + Intergenic
983957603 4:173715983-173716005 TGGGGCGGCCCCACTTGGTGAGG - Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
985787816 5:1908978-1909000 TGGGCTGGTCCCACTGGATGGGG + Intergenic
985834841 5:2262746-2262768 GGGAGTGGCCCCACTGGTTTCGG - Intergenic
985919248 5:2956834-2956856 TGTGATGGCTCCACTGGTTGTGG + Intergenic
985999185 5:3616720-3616742 TGGCCTGGCCACACTGGTTGTGG + Intergenic
986124089 5:4869361-4869383 TGTGCTTCACCCACTGGTTGGGG - Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
995313386 5:110739060-110739082 CGTGGTGGCCCCGGTGGTGGTGG + Exonic
997215021 5:132103131-132103153 TGTCGGGGTCCCACTGGTTGGGG - Intergenic
997365880 5:133324923-133324945 TGGGTTGTCCCCACTGGGTGAGG - Intronic
999373245 5:151068959-151068981 TGTGGAGGCCCCGCTGGCTGAGG - Intronic
999429306 5:151512228-151512250 TGTGGAGGCAGCACTGGGTGAGG + Exonic
999590784 5:153143363-153143385 TGTGGTGGCCCTACTACTGGGGG - Intergenic
1006639658 6:35483410-35483432 AGTGATGGCCCCACTGCCTGGGG - Intronic
1008772201 6:54992343-54992365 TGTGGAGGTGCCAGTGGTTGTGG - Intergenic
1012417529 6:99026023-99026045 TGTGGTGGCAACACAGGTTGTGG - Intergenic
1017409288 6:154151459-154151481 TGTTGTGGCCGCCATGGTTGGGG + Intronic
1018263153 6:161990149-161990171 AGTGGTGGCACCAGTGGTTTGGG - Intronic
1019292701 7:258233-258255 TGGGGTGGACCCACTGCCTGAGG + Intronic
1019292760 7:258413-258435 TGGGGTGGACCCACTGCCTGGGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019623460 7:2003622-2003644 TCCGGTGGCCCCACTGAGTGAGG - Intronic
1019682273 7:2357358-2357380 TGTCATGGCCCTCCTGGTTGTGG + Intronic
1020948306 7:14643733-14643755 TGTGGTGGCCCCACTGCTAGAGG - Intronic
1022171614 7:27837329-27837351 GGTGGTGGGCTCAGTGGTTGTGG + Intronic
1022870415 7:34472041-34472063 TGTGGTGGCCCCTCTGCTGGGGG + Intergenic
1023153410 7:37223746-37223768 TGTGGTGGCCTCCGTGATTGTGG - Intronic
1023357576 7:39382539-39382561 TGTGGTGGGCCCACTGGCCCTGG + Intronic
1023896474 7:44437579-44437601 TGTGGGGGCCACAGGGGTTGGGG + Intronic
1024574598 7:50753651-50753673 TGTGGTGGCTCCATTTGGTGGGG - Intronic
1024722431 7:52152364-52152386 TGTGGTGCCCCAAATGGTTTTGG + Intergenic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1031068761 7:117138617-117138639 TGTGGTGGTCCCATGGGTTCTGG + Intronic
1041394039 8:57373772-57373794 TGGGGTGGCCCCTCTGGAAGTGG + Intergenic
1047621165 8:126609433-126609455 AGTGGAGGCAGCACTGGTTGGGG - Intergenic
1047992114 8:130297210-130297232 TGTGGTTGTCCCACTGCCTGTGG + Intronic
1049314101 8:141950552-141950574 TGTGGTGGTGCCACTGAGTGAGG + Intergenic
1050676558 9:8062550-8062572 TGTGGTGGCCCCAATGCTGGGGG + Intergenic
1053121160 9:35548267-35548289 TCGGGGGGCCCCACTGGATGAGG + Exonic
1058327360 9:103715389-103715411 TGTGGAGGCACCACAGGCTGAGG - Intergenic
1060228391 9:121809813-121809835 TGTGGTGGTCCTGTTGGTTGGGG + Intergenic
1060819906 9:126655275-126655297 TGTGGTGGCCCCCTTCGATGAGG + Intronic
1060822205 9:126668006-126668028 TGATGTGGTCCCACTGGGTGTGG + Intronic
1062473842 9:136718114-136718136 TGTGCTGGCCTCACTGGTCCAGG + Intronic
1062473859 9:136718186-136718208 TGTGCTGGCCTCACTGGTCCAGG + Intronic
1062473866 9:136718222-136718244 TGTGCTGGCCTCACTGGTCCGGG + Intronic
1062473876 9:136718258-136718280 TGTGCTGGCCTCACTGGTCCGGG + Intronic
1062555560 9:137112146-137112168 TGTGCTGACCCCACTGGCTGCGG - Exonic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1187052338 X:15707435-15707457 TGAGGTGGCCCCAAATGTTGAGG - Intronic
1187078034 X:15955489-15955511 TTTTCTGGCCACACTGGTTGAGG + Intergenic
1188288260 X:28356002-28356024 TGTGTTGTCCCAACTGGTGGTGG + Intergenic
1189204971 X:39230042-39230064 TCTGTCGACCCCACTGGTTGAGG + Intergenic
1190396761 X:49993083-49993105 TGTGCTGGCCCCAGTGGATTTGG + Intronic
1198469019 X:136928917-136928939 TTTGGTGGCCTCATGGGTTGAGG - Intergenic
1199923904 X:152441143-152441165 TGTGGTGGCACCGGTGGTAGTGG + Intronic