ID: 1104106508

View in Genome Browser
Species Human (GRCh38)
Location 12:125664987-125665009
Sequence CTGGTGATGAGAAGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104106504_1104106508 5 Left 1104106504 12:125664959-125664981 CCAGGAATCACCTGATGTTGTCT 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 241
1104106506_1104106508 -5 Left 1104106506 12:125664969-125664991 CCTGATGTTGTCTTCATCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 241
1104106502_1104106508 25 Left 1104106502 12:125664939-125664961 CCTGAGAGATCGCTCTGGTTCCA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 241
1104106501_1104106508 26 Left 1104106501 12:125664938-125664960 CCCTGAGAGATCGCTCTGGTTCC 0: 1
1: 0
2: 1
3: 2
4: 71
Right 1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104106508 Original CRISPR CTGGTGATGAGAAGTGTGTT TGG Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900959379 1:5909507-5909529 CTAGTGAGGAGAAGCGTGTTAGG - Intronic
901232070 1:7646882-7646904 CAGGTGAGGACCAGTGTGTTAGG - Intronic
901850067 1:12009388-12009410 GTGGTGATGCTGAGTGTGTTTGG + Intronic
907473829 1:54692313-54692335 ATGGTGAAGAGAAGTTTGTCGGG + Intronic
908039204 1:60089396-60089418 ATTTTGATGAGAGGTGTGTTTGG - Intergenic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
909695638 1:78465412-78465434 CTGGTGAAGAGCAGTGGGTGAGG + Intronic
910409934 1:86931602-86931624 CTAGTGATAAGAATTGAGTTAGG + Intronic
913214655 1:116610343-116610365 CTTGAGATGAGAAGAGTCTTTGG - Intronic
913410218 1:118542738-118542760 CTGGTGATGAGAAGTGATGGGGG - Intergenic
913662630 1:121018231-121018253 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
914014017 1:143801492-143801514 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
914163806 1:145159705-145159727 GTGGTGAGGATAAGTGTGCTAGG + Intergenic
914351710 1:146845559-146845581 CTGGAGATGAGAAACTTGTTGGG - Intergenic
914652635 1:149710048-149710070 GTGGTGAGGATAAGTGTGCTAGG - Intergenic
916514116 1:165499327-165499349 CTGGAGTGGAGAAGTGTGTGGGG - Intergenic
917646877 1:177037765-177037787 TTGGTAACTAGAAGTGTGTTTGG + Intronic
919927494 1:202199744-202199766 CTGTTGATGAGCTGTGTCTTTGG + Intronic
919948081 1:202336892-202336914 CTAGAGTTGAGAAGAGTGTTGGG - Intronic
921116912 1:212100508-212100530 GTGGTGATGAGGAAGGTGTTCGG - Exonic
921184185 1:212655938-212655960 CTGGTGAGGAGAGGTGGGATGGG + Intergenic
922152845 1:223020213-223020235 CTGATGATGAGGAGTGAGGTGGG + Intergenic
922376935 1:224978492-224978514 TAGATGATGAGAAGGGTGTTGGG + Intronic
923425854 1:233868873-233868895 CTGGTGATGAGAGGTAGGCTGGG - Intergenic
923884799 1:238142539-238142561 CTGGTGATAAGAAGAATGTAGGG + Intergenic
1066046407 10:31599267-31599289 CTGATGATCGTAAGTGTGTTAGG - Intergenic
1067031687 10:42882368-42882390 CTGCTGATGTTAAGTGTGTGAGG + Intergenic
1067703399 10:48589549-48589571 ATGGGGAGGAGAAGTGGGTTGGG - Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1071230523 10:83580315-83580337 CTGGTGAAGAGCAGGGGGTTGGG + Intergenic
1072019508 10:91384062-91384084 CAGGTAATGAGGAGTGTATTTGG - Intergenic
1072194679 10:93107024-93107046 CTGGTACTGAGAAGTCTTTTTGG + Intergenic
1073942314 10:108712951-108712973 ATGGTGATGAGGAATTTGTTGGG + Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075623987 10:123948561-123948583 CTGGAGATGAGCAGTGTGGTGGG - Intergenic
1075660995 10:124196401-124196423 CTGGCCATGAGAAGAGTATTAGG + Intergenic
1077200113 11:1302539-1302561 CTGGTGCTGTGAAGGGTGGTGGG - Intronic
1077798933 11:5518861-5518883 CTGGTGATGAGAAGGGGCTGTGG - Intronic
1078135109 11:8645410-8645432 CTGGACATGAGCAGTGTGCTGGG - Intronic
1078906667 11:15693999-15694021 CTGGAGGTGAGGACTGTGTTGGG + Intergenic
1079380784 11:19935194-19935216 CTGGAGATGAGCAGTGCATTTGG + Intronic
1079925514 11:26487678-26487700 ATGGAGATGAGGAGTTTGTTGGG + Intronic
1083161599 11:60857792-60857814 CTGGTGCTGAGATGTGTCTGTGG - Intergenic
1083875790 11:65524015-65524037 CTGGTTATGAAAAGTCTGGTTGG - Intergenic
1085034686 11:73292872-73292894 CTGGTGGTCCCAAGTGTGTTGGG - Intronic
1086239187 11:84669023-84669045 CTGGTCTTGAGAAATGTGATGGG + Intronic
1087399820 11:97651490-97651512 CTGGTGATGAGTTGTGGTTTGGG + Intergenic
1089154892 11:116394151-116394173 CTTGAGATGAGAAGCGTGTCTGG + Intergenic
1089602001 11:119622128-119622150 CTTGAGAAGAGAAGTGTGTATGG + Intergenic
1090760079 11:129828779-129828801 ATGGGAATGAGACGTGTGTTTGG - Intronic
1090800118 11:130165388-130165410 GCAGTGGTGAGAAGTGTGTTTGG + Intronic
1092172461 12:6382711-6382733 CAGGTGATGGGAAGTGTGCATGG - Intronic
1092928677 12:13294981-13295003 CTGGAGTGGAGACGTGTGTTAGG + Intergenic
1094813153 12:34161701-34161723 CTGGTGTTCAGAGGTGGGTTTGG - Intergenic
1096459146 12:51812569-51812591 CTGGTGATGAGAAGCGGGGGTGG - Exonic
1096802809 12:54122651-54122673 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1098629626 12:72709678-72709700 CTAGGGATGACAAGTGTTTTGGG + Intergenic
1098961639 12:76745328-76745350 CTGGTTCTGAGAAGTCTCTTAGG - Intergenic
1100135008 12:91544220-91544242 CTGGTGATAAGAAATGGGATTGG - Intergenic
1101487367 12:105178746-105178768 CAGTTAATGAGAAGTGTGTATGG + Intronic
1103489979 12:121309896-121309918 CTGGTGAAGGGCAGTGGGTTTGG - Intronic
1103695651 12:122813458-122813480 CTGGTGTTCAGTGGTGTGTTTGG - Intronic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104392172 12:128400404-128400426 CCTATGAGGAGAAGTGTGTTAGG - Intronic
1104648901 12:130516978-130517000 CTGGTGCTGAGATGAGTGGTTGG + Intronic
1104975248 12:132549271-132549293 CGGGCGAGGAGAGGTGTGTTGGG - Intronic
1107035518 13:35898332-35898354 GGGGTAATGAGAAGTATGTTTGG - Intronic
1107401780 13:40076608-40076630 CAGGCAATGAGAAGGGTGTTAGG - Intergenic
1108060327 13:46526525-46526547 CTGAGGATGATAAATGTGTTAGG - Intergenic
1109481684 13:62963758-62963780 GTGGAGATGAGGAATGTGTTGGG + Intergenic
1110038329 13:70717574-70717596 ATGGAGATGAGAAACGTGTTGGG + Intergenic
1110819644 13:79899838-79899860 CTTGTGATGGGAAGTGCATTGGG - Intergenic
1111420121 13:88000337-88000359 CTGGTGAAGAGCAGGGGGTTGGG + Intergenic
1112753692 13:102607232-102607254 CTGGGGACCAGAAGTGTTTTAGG + Intronic
1113320733 13:109229665-109229687 CTGGAGATGAGGAATGTATTGGG - Intergenic
1116795381 14:49384609-49384631 CTGGTGATGAGCAGGGTGGTGGG - Intergenic
1116902769 14:50377624-50377646 CTGCTGATGATAAGTGGGGTGGG + Intronic
1117768537 14:59108148-59108170 CTTGTGATGTGAACTGTCTTTGG - Intergenic
1119945883 14:78693550-78693572 TTGGGGATGATATGTGTGTTTGG - Intronic
1120676042 14:87422720-87422742 GTGGGGATGAAAACTGTGTTGGG - Intergenic
1121629478 14:95412063-95412085 CAGGAGGTCAGAAGTGTGTTGGG - Intronic
1121840423 14:97129486-97129508 CTGGTGATGAGATTTGGGTGGGG + Intergenic
1122416562 14:101552496-101552518 CTGGTGAGGAGGATTGAGTTGGG + Intergenic
1123160455 14:106273926-106273948 CTGGAGATAGGAAGTGTATTTGG + Intergenic
1202836179 14_GL000009v2_random:78927-78949 CTGCTGATTAGAAATGTGGTCGG - Intergenic
1127078988 15:55357164-55357186 TTGGAGATGAGAATTGTGTTTGG - Intronic
1127631929 15:60835552-60835574 TTTGTGATGTGAAGTGAGTTGGG - Intronic
1128547875 15:68579646-68579668 CTGGTGCTGAGCAGTGGGTGTGG + Intronic
1128984291 15:72207908-72207930 TTGTGGATTAGAAGTGTGTTTGG - Intronic
1129567011 15:76633653-76633675 CTGGTGAGGAGGAGTGGATTGGG + Intronic
1132941618 16:2511378-2511400 CTGGTGATGAGAAGCGGGAGGGG + Intronic
1133704635 16:8342088-8342110 CTGATGTTGAGTAGTGTCTTAGG - Intergenic
1135955956 16:26956345-26956367 CTGCAGATGAAAAGTGTTTTAGG + Intergenic
1139982325 16:70869977-70869999 CTGGAGATGAGAAACTTGTTGGG + Intronic
1140793331 16:78412783-78412805 CTGATGATGAGAAGTAGATTTGG + Intronic
1141072893 16:80974090-80974112 CTGGGGAGGTGAAGTGTGTGTGG - Exonic
1145357117 17:22169020-22169042 GTGGAGATGAGGAATGTGTTGGG - Intergenic
1149355692 17:55837016-55837038 CTGGTGATGTGAAGGTTGTATGG + Intronic
1151316079 17:73323516-73323538 CTCTTGATGGGAAGTGTGTCTGG + Intergenic
1153390406 18:4551651-4551673 TTGATGATGAGAAGAGTGTTGGG - Intergenic
1155333405 18:24740605-24740627 CTGGTGATGAGAGAGGTCTTGGG - Intergenic
1155703750 18:28781861-28781883 TTGGGGATGGGAAGTGGGTTAGG + Intergenic
1156166882 18:34432104-34432126 CTGGGGTAGAGAAGTGTGGTGGG - Intergenic
1157727882 18:49978809-49978831 CTGGGGAGGAGCAGGGTGTTGGG + Intronic
1161548237 19:4895528-4895550 CTGGAGATGTGAAGTGACTTTGG + Intronic
1161744734 19:6048961-6048983 CTAGTGGTGAGAAGTGAGTCAGG - Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1166897134 19:46030876-46030898 CTGGTGATGACAAGGTTGTTGGG + Intergenic
1166911668 19:46163466-46163488 CTGGTGATGAGCAGTGGGAGAGG + Intergenic
1202636458 1_KI270706v1_random:48435-48457 CTGCTGATTAGAAATGTGGTCGG + Intergenic
925409159 2:3628876-3628898 ATGGTGATGAGATGTGGGATGGG + Intronic
926180988 2:10642798-10642820 GAGCTGATGAGAAGTGTGGTTGG - Intronic
928337450 2:30409849-30409871 CTGATGATGAGATGTGCATTTGG - Intergenic
928749819 2:34458410-34458432 ATGGTGATGAGAAATTTCTTGGG + Intergenic
929382620 2:41370016-41370038 CTGGAGATGAGAAACTTGTTGGG - Intergenic
930651331 2:53967736-53967758 CTGGACATCAGAGGTGTGTTTGG - Intronic
930691276 2:54368076-54368098 CTAGTCATGAAAATTGTGTTAGG - Intronic
932262795 2:70341414-70341436 GGAGTGATGGGAAGTGTGTTGGG + Intergenic
932454157 2:71835578-71835600 ATGGGAATGGGAAGTGTGTTAGG - Intergenic
933207873 2:79529995-79530017 CTGGTGATGAGAAGAGACTGTGG + Intronic
933304496 2:80580443-80580465 CTAATAATGAGAAGTATGTTTGG + Intronic
933636416 2:84713442-84713464 ATGGTGATGACAAGGGTGATTGG - Intronic
936992552 2:118381670-118381692 CTGGTGGTAAGAAGTGAATTGGG + Intergenic
937032220 2:118750243-118750265 CTGTTGTTGTGCAGTGTGTTTGG + Intergenic
938776746 2:134547864-134547886 TTGATGATGAGAAATGTCTTTGG - Intronic
939155967 2:138524738-138524760 ATGGAGATGAGGAATGTGTTAGG - Intronic
940790852 2:158028412-158028434 ATGGTGATGAGGAGCTTGTTGGG - Intronic
941344385 2:164348918-164348940 CAGGTGATGAGGAATGGGTTTGG + Intergenic
942821457 2:180120697-180120719 CTGGTCATCAGAAGTATGGTAGG - Intergenic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946652550 2:221909175-221909197 CTTGTGATCAGAAGTGTCTCAGG + Intergenic
947097492 2:226582548-226582570 TTGGTGAGGAGTAGTGTATTTGG - Intergenic
947856642 2:233328665-233328687 CTGGTGAAGAGAGGGGTGTGGGG - Intronic
948658444 2:239491590-239491612 CTGGTGATGGGCAGAGAGTTTGG + Intergenic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170993993 20:21334437-21334459 CTATTGATTAGAAATGTGTTTGG - Intronic
1171277551 20:23870767-23870789 CAGGGCATGAGAAGAGTGTTGGG + Intergenic
1171854525 20:30332454-30332476 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1173183614 20:40822452-40822474 CTGCTTAGGAGAAGGGTGTTGGG - Intergenic
1173479056 20:43384736-43384758 TAGGTTATGAGAAATGTGTTAGG + Intergenic
1175815141 20:61879437-61879459 CTGGTGCTGAGAAGTATCTCTGG - Intronic
1177067862 21:16463459-16463481 ATGGAGATGAGGAATGTGTTGGG + Intergenic
1177504436 21:22001690-22001712 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1178115472 21:29412300-29412322 CTGGTGATAATATGTGTGCTGGG + Intronic
1178469105 21:32875813-32875835 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1179000822 21:37456482-37456504 CGGGTGATGAGCAGGCTGTTTGG + Intronic
1181873550 22:25922375-25922397 CTAGTGTTGAGAAGTGTGAATGG + Intronic
1182056367 22:27358450-27358472 CTGGTGCTCAGAAGTGTTTGTGG - Intergenic
1183276558 22:36901651-36901673 CTGCTGGTGAGATGTGTGTTGGG + Intergenic
1184259106 22:43304563-43304585 TTGGTGGTGAGAAGTGCGGTTGG + Intronic
1184840207 22:47048179-47048201 CTGCTGCTGAGAGGTGTGTGTGG + Intronic
950136829 3:10586982-10587004 CTGGTGGTGCTAAGTGTGTGAGG - Intronic
950447859 3:13048477-13048499 CAGGTGGGGAGAAGTGTGTGAGG - Intronic
950848044 3:16034015-16034037 ATGGTGATGTGAATTGTGATGGG + Intergenic
952015262 3:28949161-28949183 GTGGTGAATAGAAGTGTGTTGGG + Intergenic
952717519 3:36494997-36495019 ATGTTGATGAGAAGAGTGTCAGG - Intronic
953454318 3:43029832-43029854 ACGGTGCTGAGAAATGTGTTCGG + Intronic
954708166 3:52492075-52492097 CTGGTGAGCAGGAGTGTCTTGGG - Exonic
960060081 3:113311846-113311868 ATGGAGATGAGAAGCTTGTTGGG + Intronic
960881794 3:122353004-122353026 CTGCTGATGGAAAGAGTGTTTGG + Intergenic
961588949 3:127960537-127960559 CTTTTGATGAGAGGTGTCTTGGG - Intronic
961599345 3:128047067-128047089 CTGGTGCTCAGAAATGAGTTAGG - Intergenic
965011203 3:163094644-163094666 ATGGTGAAGAGAAGTATCTTGGG + Intergenic
966025605 3:175276862-175276884 GTGGTGAGGTGAAGTGAGTTGGG - Intronic
966403051 3:179566092-179566114 CTGGTGGTCAGCAATGTGTTAGG + Intronic
967135921 3:186512609-186512631 CTGGTGATATGAACTGTGATAGG + Intergenic
968862502 4:3184135-3184157 CTGGTGATGAGAAGAAGCTTTGG + Intronic
970271743 4:14355352-14355374 ATGGGGATGATACGTGTGTTAGG + Intergenic
972699892 4:41483625-41483647 GTGGGGATGAGAAGGGTGGTAGG - Intronic
973394341 4:49580631-49580653 CTGCTGATTAGAAATGTGGTCGG - Intergenic
975991533 4:80264243-80264265 TTGGTGATCATAAGTGTGTAGGG - Intergenic
977002151 4:91518334-91518356 CTGGTTATGAGCAGGGGGTTTGG + Intronic
977678601 4:99774323-99774345 CTGGTGAAGAGGAGTGGATTGGG - Intergenic
977819877 4:101458891-101458913 CTGGTGATGAGTTGGGTGGTGGG - Intronic
978247704 4:106595030-106595052 GAAGTGATGAGAAGTGGGTTAGG - Intergenic
979858577 4:125665005-125665027 CTGGTGATGGGGAGTGGGGTGGG + Intergenic
981337304 4:143581712-143581734 CTGGTGAAGAGCAGGGGGTTGGG - Intronic
982463733 4:155704456-155704478 ATGTTGTTGAGATGTGTGTTGGG - Intronic
984131350 4:175879087-175879109 ATGGAGATGAGAAATTTGTTGGG - Intronic
1202763773 4_GL000008v2_random:134305-134327 CTGCTGATTAGAAATGTGGTCGG + Intergenic
985972855 5:3392061-3392083 CTGGAGCTGAGCAGTATGTTGGG + Intergenic
986038102 5:3960174-3960196 CAGGTGCTGGGAAATGTGTTTGG + Intergenic
986266844 5:6198015-6198037 CTGGTGAGCAGAAGTGTGTCTGG - Intergenic
987881978 5:23759919-23759941 GTGGTCATGCTAAGTGTGTTGGG - Intergenic
993413279 5:87597233-87597255 ATGGAGATGAGAAGCTTGTTGGG - Intergenic
994749698 5:103722328-103722350 ATGGAGATGAGAAATGTGTTGGG - Intergenic
995534564 5:113122198-113122220 GTTGTGTTGAGAAGTGAGTTGGG - Intronic
996354689 5:122582519-122582541 CAGGTGATGAGAACTCTGTATGG - Intergenic
996561335 5:124832811-124832833 CTGGTGATAAGAATTGTCTCTGG + Intergenic
997313009 5:132905284-132905306 CTGGTCATGAAAATTGAGTTTGG - Intronic
997850177 5:137325405-137325427 CTCTTGATGAGGAGGGTGTTGGG - Intronic
997988082 5:138520471-138520493 GTAGTGATGATAAGTGTCTTTGG - Intronic
999177277 5:149640344-149640366 CTGCTGTTGAGACTTGTGTTTGG - Intergenic
999418082 5:151417364-151417386 ATGGTGATGAGAAACTTGTTGGG + Intergenic
999435602 5:151561101-151561123 GTGGTGCTGGAAAGTGTGTTAGG + Intronic
1000648524 5:163786390-163786412 ATGGAGATGAGGAGTTTGTTGGG - Intergenic
1000759664 5:165206673-165206695 CTGGGAAAGAGAAGTGTGTGGGG + Intergenic
1001473470 5:172032457-172032479 ATGAAGATGAGAAATGTGTTGGG - Intergenic
1006636861 6:35467486-35467508 CTGGTGAGGGGAAGGGTGTAGGG + Intergenic
1010530887 6:76966178-76966200 CTGGAGATGAGAAACTTGTTGGG + Intergenic
1010757341 6:79681723-79681745 CCTGGGATCAGAAGTGTGTTTGG + Intronic
1011956484 6:93030483-93030505 TTGGTGATGAGGAATTTGTTGGG - Intergenic
1012788253 6:103658985-103659007 ATGGAGATGAGAAATTTGTTGGG - Intergenic
1013213806 6:108009245-108009267 ATGGTGATGAGAAACTTGTTGGG - Intergenic
1013593766 6:111643528-111643550 ATGATGTTGAGAAGTGTGTGTGG + Intergenic
1014115967 6:117669431-117669453 ATGGAGATGAGGAGTTTGTTGGG + Intergenic
1015239518 6:131007674-131007696 ATGGAGATGAGGAATGTGTTGGG + Intronic
1016330998 6:142951794-142951816 CTGGGGATGAGAAGGGTGCAGGG + Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1017664792 6:156709198-156709220 GTGGAGATGGGAAGTGTATTAGG + Intergenic
1020619110 7:10496924-10496946 CTGGTGAAGAGGAATGGGTTAGG - Intergenic
1021861322 7:24908885-24908907 CTTTTGAGGACAAGTGTGTTTGG - Intronic
1026529047 7:71181497-71181519 CTGGTGATGAGAAGGATGAAGGG + Intronic
1026679149 7:72452119-72452141 CTGGTTATGTTAGGTGTGTTAGG + Intergenic
1027977516 7:85178445-85178467 ATGGAGATGAGAAATGTGTTGGG + Intronic
1028367731 7:90053939-90053961 CTGGTGATGTGTATTGTGCTTGG - Intergenic
1030479097 7:110079852-110079874 CTGCTGATATGAAGAGTGTTTGG - Intergenic
1030891452 7:115004085-115004107 CTGGTGATGAGAACAGCCTTTGG + Intronic
1034169394 7:149051054-149051076 GTGGTGATGAGAGGTGTTATTGG - Intergenic
1034816512 7:154176500-154176522 ATGGTAAGGACAAGTGTGTTTGG + Intronic
1034926265 7:155124889-155124911 CTGGTGATGAGGAGAGTGGGCGG + Intergenic
1037388305 8:18365892-18365914 CTGGTGATAAGTAGGGTGTGGGG - Intergenic
1037821009 8:22134502-22134524 CTGGTGGCGAGAAGAGGGTTGGG + Intergenic
1038127810 8:24693753-24693775 CAGGTGAGGGGAAGTGTGATCGG + Intergenic
1039657355 8:39424079-39424101 ATGGAGATGAGAAATGTGTTGGG - Intergenic
1044129366 8:88501692-88501714 CTGATGATTAGTAGTGTGTCAGG + Intergenic
1044146821 8:88726019-88726041 CTGGTATTGATAAGTGTTTTAGG - Intergenic
1044146887 8:88727514-88727536 CTGGTATTGATAAGTGTTTTAGG + Intergenic
1045406454 8:101871468-101871490 CTGTTGAGGGGAACTGTGTTGGG - Intronic
1048625039 8:136175889-136175911 CTGGGGATCAGAAGTGAGGTTGG + Intergenic
1049200222 8:141336456-141336478 CTGGTGCTGGGAAGTGGGGTTGG + Intergenic
1049608969 8:143543849-143543871 TAGGAAATGAGAAGTGTGTTAGG + Intergenic
1050869480 9:10549295-10549317 CTGGTGATTAGAGGGCTGTTCGG - Intronic
1051285674 9:15493305-15493327 ATGGAGATGAGGAGCGTGTTGGG - Intronic
1053792343 9:41695734-41695756 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1054180752 9:61907754-61907776 CTGGTGAGGTCAAGTGTGTGTGG + Intergenic
1054472605 9:65550234-65550256 CTGGTGAGGTCAAGTGTGTGTGG - Intergenic
1054656839 9:67673388-67673410 CTGGTGAGGTCAAGTGTGTGTGG - Intergenic
1057218082 9:93240498-93240520 CTGTGGATGAGGAGTGGGTTGGG + Intronic
1058779362 9:108317877-108317899 CTGGGGATCAGCAGTGTGTGTGG + Intergenic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1060877259 9:127092324-127092346 CTGGAGATGAGCTGTGTGTGAGG + Intronic
1061768512 9:132898882-132898904 GGGGTGATGAGAAGTATGGTGGG + Intronic
1061902420 9:133679814-133679836 CTGGTGGTGAGGAGGGTCTTTGG + Intronic
1062289270 9:135787250-135787272 CTTGTGGTGGGAAGTGTGCTTGG + Intronic
1203544527 Un_KI270743v1:119178-119200 CTGCTGATTAGAAATGTGGTCGG + Intergenic
1189839659 X:45060991-45061013 GTGATGATGAAAAGTGTGCTGGG - Intronic
1193985704 X:88238066-88238088 CTGGTGATGAGGATTGTGATCGG + Intergenic
1194299024 X:92162672-92162694 CCTGTGATGTGAAGTGTCTTCGG + Intronic
1194841619 X:98751432-98751454 CTGGAGATGAGATTTGTGTGGGG + Intergenic
1195403432 X:104486902-104486924 CTGGGCATGAGGAGTGTTTTCGG + Intergenic
1195525997 X:105890220-105890242 ATGGAGATGAGAAATTTGTTGGG - Intronic
1197850940 X:130859539-130859561 CTGGTGATGAGAAATGTAGAGGG + Intronic
1198648654 X:138837404-138837426 CTGGTGATGAGAAATGGGGTTGG + Intronic
1198705437 X:139443519-139443541 CTAGTGATGAGGAGTGGGATTGG - Intergenic
1200616627 Y:5387506-5387528 CCTGTGATGTGAAGTGTCTTCGG + Intronic