ID: 1104109076

View in Genome Browser
Species Human (GRCh38)
Location 12:125688843-125688865
Sequence TGCTGCTGGTCCTCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104109076_1104109081 4 Left 1104109076 12:125688843-125688865 CCTGCATGTGAGGACCAGCAGCA No data
Right 1104109081 12:125688870-125688892 AGTCATGTGGCCATTTATCCAGG No data
1104109076_1104109084 20 Left 1104109076 12:125688843-125688865 CCTGCATGTGAGGACCAGCAGCA No data
Right 1104109084 12:125688886-125688908 ATCCAGGGCACCTAAAACTATGG No data
1104109076_1104109080 -9 Left 1104109076 12:125688843-125688865 CCTGCATGTGAGGACCAGCAGCA No data
Right 1104109080 12:125688857-125688879 CCAGCAGCAAGGGAGTCATGTGG No data
1104109076_1104109082 5 Left 1104109076 12:125688843-125688865 CCTGCATGTGAGGACCAGCAGCA No data
Right 1104109082 12:125688871-125688893 GTCATGTGGCCATTTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104109076 Original CRISPR TGCTGCTGGTCCTCACATGC AGG (reversed) Intergenic
No off target data available for this crispr