ID: 1104110543

View in Genome Browser
Species Human (GRCh38)
Location 12:125700409-125700431
Sequence CTATTTTTCCAAAGCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104110540_1104110543 19 Left 1104110540 12:125700367-125700389 CCCATTATATAGATGAGAAGACT No data
Right 1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG No data
1104110538_1104110543 27 Left 1104110538 12:125700359-125700381 CCTGTATCCCCATTATATAGATG No data
Right 1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG No data
1104110539_1104110543 20 Left 1104110539 12:125700366-125700388 CCCCATTATATAGATGAGAAGAC No data
Right 1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG No data
1104110541_1104110543 18 Left 1104110541 12:125700368-125700390 CCATTATATAGATGAGAAGACTG No data
Right 1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104110543 Original CRISPR CTATTTTTCCAAAGCTACAT AGG Intergenic
No off target data available for this crispr