ID: 1104112023

View in Genome Browser
Species Human (GRCh38)
Location 12:125713093-125713115
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104112020_1104112023 2 Left 1104112020 12:125713068-125713090 CCTGAGCAGAGAGTGGCTCTCTG No data
Right 1104112023 12:125713093-125713115 GACTCAGCTGTGGATCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104112023 Original CRISPR GACTCAGCTGTGGATCCTTT GGG Intergenic
No off target data available for this crispr