ID: 1104119865

View in Genome Browser
Species Human (GRCh38)
Location 12:125788991-125789013
Sequence CTCCAGAGGAGGGTCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104119859_1104119865 21 Left 1104119859 12:125788947-125788969 CCAAGGAAATTTTGCTTGGGTAG No data
Right 1104119865 12:125788991-125789013 CTCCAGAGGAGGGTCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104119865 Original CRISPR CTCCAGAGGAGGGTCTTGGG AGG Intergenic
No off target data available for this crispr