ID: 1104121830

View in Genome Browser
Species Human (GRCh38)
Location 12:125807299-125807321
Sequence ATTTACAAAACACTTATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104121830_1104121833 13 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121833 12:125807335-125807357 TTTCTTCTCTCTACGGCCAGTGG No data
1104121830_1104121835 15 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121835 12:125807337-125807359 TCTTCTCTCTACGGCCAGTGGGG No data
1104121830_1104121834 14 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121834 12:125807336-125807358 TTCTTCTCTCTACGGCCAGTGGG No data
1104121830_1104121839 29 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121839 12:125807351-125807373 CCAGTGGGGAGCCTGCTGGTGGG No data
1104121830_1104121832 6 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121832 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
1104121830_1104121836 25 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121836 12:125807347-125807369 ACGGCCAGTGGGGAGCCTGCTGG No data
1104121830_1104121837 28 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121837 12:125807350-125807372 GCCAGTGGGGAGCCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104121830 Original CRISPR ATTTACAAAACACTTATCCA TGG (reversed) Intergenic