ID: 1104121831

View in Genome Browser
Species Human (GRCh38)
Location 12:125807328-125807350
Sequence CCGTAGAGAGAAGAAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104121831_1104121840 5 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121840 12:125807356-125807378 GGGGAGCCTGCTGGTGGGAGAGG No data
1104121831_1104121839 0 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121839 12:125807351-125807373 CCAGTGGGGAGCCTGCTGGTGGG No data
1104121831_1104121836 -4 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121836 12:125807347-125807369 ACGGCCAGTGGGGAGCCTGCTGG No data
1104121831_1104121841 8 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121841 12:125807359-125807381 GAGCCTGCTGGTGGGAGAGGTGG No data
1104121831_1104121837 -1 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121837 12:125807350-125807372 GCCAGTGGGGAGCCTGCTGGTGG No data
1104121831_1104121843 19 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121843 12:125807370-125807392 TGGGAGAGGTGGCGATTCTTAGG No data
1104121831_1104121844 20 Left 1104121831 12:125807328-125807350 CCTCACTTTTCTTCTCTCTACGG No data
Right 1104121844 12:125807371-125807393 GGGAGAGGTGGCGATTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104121831 Original CRISPR CCGTAGAGAGAAGAAAAGTG AGG (reversed) Intergenic