ID: 1104121835

View in Genome Browser
Species Human (GRCh38)
Location 12:125807337-125807359
Sequence TCTTCTCTCTACGGCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104121830_1104121835 15 Left 1104121830 12:125807299-125807321 CCATGGATAAGTGTTTTGTAAAT No data
Right 1104121835 12:125807337-125807359 TCTTCTCTCTACGGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104121835 Original CRISPR TCTTCTCTCTACGGCCAGTG GGG Intergenic
No off target data available for this crispr