ID: 1104124872

View in Genome Browser
Species Human (GRCh38)
Location 12:125836990-125837012
Sequence TGGGTTGCACGAGTGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104124872_1104124877 -9 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124877 12:125837004-125837026 TGCAACCCAGTTTTAGGGGTGGG No data
1104124872_1104124876 -10 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124876 12:125837003-125837025 GTGCAACCCAGTTTTAGGGGTGG No data
1104124872_1104124879 -5 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124879 12:125837008-125837030 ACCCAGTTTTAGGGGTGGGAGGG No data
1104124872_1104124882 -1 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124882 12:125837012-125837034 AGTTTTAGGGGTGGGAGGGTAGG No data
1104124872_1104124883 0 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124883 12:125837013-125837035 GTTTTAGGGGTGGGAGGGTAGGG No data
1104124872_1104124884 5 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124884 12:125837018-125837040 AGGGGTGGGAGGGTAGGGACAGG No data
1104124872_1104124885 17 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124885 12:125837030-125837052 GTAGGGACAGGAACTCTTCTAGG No data
1104124872_1104124878 -6 Left 1104124872 12:125836990-125837012 CCACAAAACACTCGTGCAACCCA No data
Right 1104124878 12:125837007-125837029 AACCCAGTTTTAGGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104124872 Original CRISPR TGGGTTGCACGAGTGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr