ID: 1104125121

View in Genome Browser
Species Human (GRCh38)
Location 12:125838818-125838840
Sequence TCACATATCTGGTTCCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104125121_1104125131 30 Left 1104125121 12:125838818-125838840 CCCAAATGGAACCAGATATGTGA No data
Right 1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG No data
1104125121_1104125127 -10 Left 1104125121 12:125838818-125838840 CCCAAATGGAACCAGATATGTGA No data
Right 1104125127 12:125838831-125838853 AGATATGTGAAGAGTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104125121 Original CRISPR TCACATATCTGGTTCCATTT GGG (reversed) Intergenic
No off target data available for this crispr