ID: 1104125122

View in Genome Browser
Species Human (GRCh38)
Location 12:125838819-125838841
Sequence TTCACATATCTGGTTCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104125122_1104125132 30 Left 1104125122 12:125838819-125838841 CCAAATGGAACCAGATATGTGAA No data
Right 1104125132 12:125838872-125838894 ACCACGTGTTGTTACAAAAAGGG No data
1104125122_1104125131 29 Left 1104125122 12:125838819-125838841 CCAAATGGAACCAGATATGTGAA No data
Right 1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104125122 Original CRISPR TTCACATATCTGGTTCCATT TGG (reversed) Intergenic
No off target data available for this crispr