ID: 1104125131

View in Genome Browser
Species Human (GRCh38)
Location 12:125838871-125838893
Sequence AACCACGTGTTGTTACAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104125121_1104125131 30 Left 1104125121 12:125838818-125838840 CCCAAATGGAACCAGATATGTGA No data
Right 1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG No data
1104125126_1104125131 19 Left 1104125126 12:125838829-125838851 CCAGATATGTGAAGAGTAGGGGA No data
Right 1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG No data
1104125122_1104125131 29 Left 1104125122 12:125838819-125838841 CCAAATGGAACCAGATATGTGAA No data
Right 1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104125131 Original CRISPR AACCACGTGTTGTTACAAAA AGG Intergenic
No off target data available for this crispr