ID: 1104128674

View in Genome Browser
Species Human (GRCh38)
Location 12:125872053-125872075
Sequence ACTCATGGTGTGCCCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104128674_1104128678 8 Left 1104128674 12:125872053-125872075 CCTGGATGGGGCACACCATGAGT No data
Right 1104128678 12:125872084-125872106 GGAACAAAACAGATATGCTATGG No data
1104128674_1104128679 20 Left 1104128674 12:125872053-125872075 CCTGGATGGGGCACACCATGAGT No data
Right 1104128679 12:125872096-125872118 ATATGCTATGGTCAGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104128674 Original CRISPR ACTCATGGTGTGCCCCATCC AGG (reversed) Intergenic
No off target data available for this crispr