ID: 1104129558

View in Genome Browser
Species Human (GRCh38)
Location 12:125880058-125880080
Sequence TGAGGTTTGCTTACTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104129558_1104129565 23 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129565 12:125880104-125880126 CAAGACTCCTTGGAGCTACTAGG No data
1104129558_1104129563 -5 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129563 12:125880076-125880098 CCTCACTTTGCTGCTATCAGGGG No data
1104129558_1104129561 -6 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129561 12:125880075-125880097 ACCTCACTTTGCTGCTATCAGGG No data
1104129558_1104129564 13 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129564 12:125880094-125880116 AGGGGAGAAACAAGACTCCTTGG No data
1104129558_1104129566 24 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129566 12:125880105-125880127 AAGACTCCTTGGAGCTACTAGGG No data
1104129558_1104129560 -7 Left 1104129558 12:125880058-125880080 CCCACTGGAGTAAGCAAACCTCA No data
Right 1104129560 12:125880074-125880096 AACCTCACTTTGCTGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104129558 Original CRISPR TGAGGTTTGCTTACTCCAGT GGG (reversed) Intergenic
No off target data available for this crispr