ID: 1104134015

View in Genome Browser
Species Human (GRCh38)
Location 12:125920302-125920324
Sequence CTCTAACACAATTGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104134015_1104134019 17 Left 1104134015 12:125920302-125920324 CCCTGCAGCCAATTGTGTTAGAG No data
Right 1104134019 12:125920342-125920364 GTTTATGACTCAGTCATACAAGG No data
1104134015_1104134022 25 Left 1104134015 12:125920302-125920324 CCCTGCAGCCAATTGTGTTAGAG No data
Right 1104134022 12:125920350-125920372 CTCAGTCATACAAGGTGCTGGGG No data
1104134015_1104134020 23 Left 1104134015 12:125920302-125920324 CCCTGCAGCCAATTGTGTTAGAG No data
Right 1104134020 12:125920348-125920370 GACTCAGTCATACAAGGTGCTGG No data
1104134015_1104134021 24 Left 1104134015 12:125920302-125920324 CCCTGCAGCCAATTGTGTTAGAG No data
Right 1104134021 12:125920349-125920371 ACTCAGTCATACAAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104134015 Original CRISPR CTCTAACACAATTGGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr