ID: 1104136265

View in Genome Browser
Species Human (GRCh38)
Location 12:125941974-125941996
Sequence AGGATTTTTACATCCTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104136264_1104136265 -7 Left 1104136264 12:125941958-125941980 CCTCAGTAGATCTTGGAGGATTT No data
Right 1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG No data
1104136261_1104136265 21 Left 1104136261 12:125941930-125941952 CCTTTCTGATAAATGAAGCTATC No data
Right 1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG No data
1104136260_1104136265 22 Left 1104136260 12:125941929-125941951 CCCTTTCTGATAAATGAAGCTAT No data
Right 1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104136265 Original CRISPR AGGATTTTTACATCCTTTGA AGG Intergenic
No off target data available for this crispr