ID: 1104138807

View in Genome Browser
Species Human (GRCh38)
Location 12:125966722-125966744
Sequence CTTAGTCAGAAGTGAATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104138807 Original CRISPR CTTAGTCAGAAGTGAATCCA AGG (reversed) Intergenic
903695447 1:25202913-25202935 ATTAGTCAGAGCTGAGTCCACGG - Intergenic
906494995 1:46299196-46299218 CTTAGTTAAATGTGAATCCTTGG + Intronic
907062518 1:51444956-51444978 ATCAGTCAGAAGTTAATCAAGGG - Exonic
909432408 1:75604733-75604755 CTTGGTTAGAGGTGAAACCAAGG + Intronic
918145425 1:181751987-181752009 CTGAGTCAGATTTGACTCCAGGG - Intronic
920539188 1:206764723-206764745 CTTTGTCAGAAGTACAGCCAGGG - Intergenic
923817507 1:237397448-237397470 CCAAGTCATAAGTGAATACATGG + Intronic
1064772270 10:18735687-18735709 GTTGGTCTGATGTGAATCCAAGG + Intergenic
1066362026 10:34740300-34740322 CTGAGACAGCAGTGAATTCAAGG + Intronic
1067346487 10:45442137-45442159 CTCAGCCAGAAATGGATCCAGGG + Intronic
1067409488 10:46052046-46052068 ATTATGCAGAAATGAATCCATGG - Intergenic
1070716958 10:78729399-78729421 CTTTCTCAGAAGGGAATCCAAGG - Intergenic
1073635930 10:105199038-105199060 CTTGGGCAGAGGAGAATCCAGGG + Intronic
1075236066 10:120730024-120730046 GGTATTCAGAAGAGAATCCAGGG + Intergenic
1079506920 11:21163405-21163427 GATAGTCAGAAGTAAATCAATGG + Intronic
1082637199 11:55610845-55610867 CTTAGTCTGAGGTGTATCCCAGG - Intergenic
1083928422 11:65823736-65823758 CCTAGTCAGCAGTGAATGAATGG - Intronic
1088105281 11:106200105-106200127 CTTAGCCAGAAGTGAAGCACAGG - Intergenic
1089550051 11:119267511-119267533 CTGAGTCTGAAGTGAATACAGGG - Intronic
1093707365 12:22289076-22289098 TTTTGTCAGAAGTGCATCCTAGG + Intronic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1095852676 12:46828051-46828073 CTTAGTCAGTAGAGAATGCTTGG - Intronic
1098009558 12:66036267-66036289 CTTTGGCAGAACTGAAGCCATGG - Intergenic
1099269336 12:80487617-80487639 CTAAGTCAGAAGTGACTCCAAGG - Intronic
1102742910 12:115223842-115223864 GTTTGTTAGAAGTGATTCCAAGG + Intergenic
1104138807 12:125966722-125966744 CTTAGTCAGAAGTGAATCCAAGG - Intergenic
1107111136 13:36699324-36699346 CATAGTCAGAAGTGACTACAGGG - Intergenic
1107264221 13:38532767-38532789 CTTTGTCAGAATTGAAGGCAAGG - Intergenic
1107392450 13:39981353-39981375 CTTAGGAAGAAGTTAACCCAGGG - Intergenic
1108100586 13:46949783-46949805 CTAAGTCAGAAGTGACTTCTGGG + Intergenic
1109447995 13:62470503-62470525 CTTAGGCAGAAGAGAATCCTGGG + Intergenic
1109653064 13:65353797-65353819 CTTAGACAGATGTGAATCTTGGG - Intergenic
1111757385 13:92415494-92415516 CTCAGTCAAGAGTGAATTCATGG - Intronic
1112767104 13:102756887-102756909 CCTAGACAGAAGTTAATCCTCGG - Intronic
1113898426 13:113781600-113781622 CTTAGACAGAAGTGCACACAAGG + Intronic
1115792961 14:36900270-36900292 TTTAGTCACATGTGAATCCCTGG + Intronic
1115954462 14:38762653-38762675 CTTGATCAGAAGTGTATTCAGGG + Intergenic
1117543675 14:56772678-56772700 CCTAGGCAGAAGAGAGTCCATGG + Intergenic
1117593658 14:57304125-57304147 CTTAGTAAGAAGGAGATCCAAGG + Intergenic
1119389669 14:74282476-74282498 CTGTGTAAGAAGTGAAACCAAGG + Intergenic
1121379439 14:93450064-93450086 CAAAGTCAGAAGTGAGTCCTGGG + Intronic
1129309350 15:74695372-74695394 CAAAGGCAGAAATGAATCCAGGG + Intronic
1130299678 15:82670408-82670430 CTTTGTCAAAAATGAATTCACGG - Intronic
1133596836 16:7302100-7302122 CCTAGGCAGAAGTTCATCCAGGG - Intronic
1133874706 16:9722922-9722944 CTTAGTCAGAAGAAAATACCTGG - Intergenic
1134364235 16:13561934-13561956 TTTAGGCAGGAGTGGATCCAGGG + Intergenic
1136046203 16:27617230-27617252 TTTAGGCATAGGTGAATCCAGGG + Intronic
1137786307 16:51140433-51140455 CTCAGTCAAAAGTGACTCCGGGG - Exonic
1143262097 17:5607096-5607118 CTTAGTGAGTAGAGAAGCCAGGG + Intronic
1148562445 17:48613700-48613722 ATTAGACACAAGTGAATCTAAGG + Intronic
1150295351 17:64004471-64004493 CTAATTCAAAAGAGAATCCAGGG - Intronic
1159047232 18:63380937-63380959 ATCAGTCAGAAGAGAATGCAGGG - Intergenic
1159106626 18:64008556-64008578 CTTATTCAGTAGTGAACCCTAGG + Intergenic
1160138075 18:76291350-76291372 CTTTGTCAGAAATGAGTTCACGG + Intergenic
926233360 2:11021447-11021469 CTCAGACAGAAGTCTATCCAGGG + Intergenic
927084548 2:19661503-19661525 CTTTGTCATGAATGAATCCATGG + Intergenic
928592975 2:32835984-32836006 TTTAGTCACAGGTGATTCCAGGG + Intergenic
928777634 2:34785203-34785225 CTTTGAAAGAAGTGAATCCCAGG - Intergenic
929718494 2:44339223-44339245 CTTATCCAGAAGCGAATACATGG - Exonic
932520034 2:72402417-72402439 CTTTGGCAAAAGTGAATTCATGG - Intronic
933657473 2:84901347-84901369 CCAAGTCATAAGTGAATACAAGG + Intronic
936007584 2:108905081-108905103 ATTAGTCAGGGGTGAATCCCAGG - Intronic
940038266 2:149331357-149331379 CTTAGCCAAATGTGAATCAACGG - Intronic
940491097 2:154362025-154362047 CTTAGTTAGAGCTGATTCCATGG - Intronic
940839298 2:158560539-158560561 CTTAGTAAAAATGGAATCCAAGG + Intronic
941233841 2:162944630-162944652 TTTGGCCAGAAGGGAATCCACGG + Intergenic
945365203 2:208944497-208944519 CTTACAGAGAAGTGAAACCATGG + Intergenic
947098352 2:226592042-226592064 CTGAGTCAGAACTGAATTCCCGG - Intergenic
1170969476 20:21104038-21104060 CCTAGACAGAAGTGAGTCCTTGG - Intergenic
1173523450 20:43715566-43715588 CTTAGTTACAAGTGAAACCCAGG - Intronic
1173748366 20:45455802-45455824 CAGAGTCAGATTTGAATCCATGG - Intergenic
1175060177 20:56234814-56234836 CTTTGTCAGGAGTGAATCAGTGG - Intergenic
1175322458 20:58098908-58098930 CTGATTCAGAAGTGAAGCAAAGG - Intergenic
1175856584 20:62123642-62123664 CTTAGGCAGACGTGGCTCCACGG - Intronic
1177501046 21:21955672-21955694 CTCACTCAGAATTGAGTCCAAGG - Intergenic
1177628391 21:23695625-23695647 CATATTCAGAGGTGAATCCCTGG + Intergenic
1177904350 21:26957788-26957810 CTAACTCAGAAGTGTATTCATGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178906918 21:36644083-36644105 CTAAGTCTGCAGTGAAGCCAGGG - Intergenic
1183183104 22:36274786-36274808 CCCAGTGAGAAGGGAATCCAAGG + Intergenic
1183403564 22:37618803-37618825 CTTAGGAAGAAATGATTCCAGGG + Intronic
1185076973 22:48688608-48688630 CTTACTTAGAAATGAACCCAGGG - Intronic
951214751 3:20013593-20013615 ATTAGTCAGGAGTGAAGGCAGGG - Intergenic
954098616 3:48352010-48352032 CTTATTCAGAAGTGAATCAGAGG + Intergenic
954686827 3:52375529-52375551 CTGAGTGAGAGGTGAACCCAGGG - Intronic
954817766 3:53296506-53296528 CTTAGTCACTTGTGAATTCATGG + Intronic
954920774 3:54189003-54189025 CTGAGTCAAAAGTGAAGCCATGG + Intronic
955202017 3:56859838-56859860 CTTAATCAGAAGTGTACCAACGG - Intronic
957262359 3:77918970-77918992 CTTAGGAATAAATGAATCCAAGG - Intergenic
962019079 3:131477950-131477972 CTTAGTGAGAAGAGAATCAGAGG - Intronic
969540546 4:7786097-7786119 CTTATTCAGACCTGAAACCAGGG + Intronic
970709652 4:18847006-18847028 CTTAATCAGCATTGATTCCAAGG + Intergenic
971143840 4:23954303-23954325 TTTACTAAGAAGTTAATCCAAGG + Intergenic
971323920 4:25628574-25628596 CATAATCAGAGGTGAAACCAAGG - Intergenic
973891582 4:55372771-55372793 TTTAGTCAGTAGTTAATCAAGGG - Exonic
975979157 4:80136063-80136085 CTAAGTGAGAAGTAAGTCCAAGG - Intergenic
983125167 4:163942563-163942585 ATTAGGCAGAAGTGTATTCAAGG - Intronic
993119773 5:83760418-83760440 CTTAGGTAGAAGTGAAAGCATGG - Intergenic
996490703 5:124092200-124092222 CTTATTGAGAAATTAATCCAGGG + Intergenic
998098251 5:139410112-139410134 TTTAGTCGGAAGTGGCTCCAAGG + Intronic
998172835 5:139882556-139882578 CTTAGTCAGAGGGGCCTCCAGGG - Intronic
1000194333 5:158943119-158943141 ATGAGTCACAAATGAATCCAGGG + Intronic
1002023825 5:176383527-176383549 CTCGGTCTGAAGTGAATCCGAGG - Intronic
1008619868 6:53261174-53261196 CTGAGCCAGCAGTGAATCCCTGG + Intergenic
1011605174 6:89096549-89096571 CCTAGTCAGAGGTAAATCAAAGG + Exonic
1014118338 6:117691935-117691957 CTTGGTAAAAAGTGAATACATGG + Intronic
1015842751 6:137491279-137491301 CTTATTCAGAAGCAAATCCTGGG + Intergenic
1018542132 6:164893571-164893593 CTTGGTAAAAAGTGAATGCATGG + Intergenic
1018548499 6:164964385-164964407 CTCAGCCAGACGTGAATGCATGG + Intergenic
1020417032 7:7958357-7958379 GATAGTCAGAAGTGAATATAGGG - Intronic
1025628241 7:63243452-63243474 CGTATTCAGAAATGAATACAGGG - Intergenic
1027451575 7:78337392-78337414 CTTAGTCAGCACTGACTCCTGGG - Intronic
1028639012 7:93022411-93022433 CAGAGCCAGAAATGAATCCATGG + Intergenic
1029839726 7:103349394-103349416 GTTAGTCATAACTGTATCCAAGG - Intronic
1030476742 7:110043704-110043726 CTTAGTCAGAGGGGAATCATTGG - Intergenic
1033724890 7:144104414-144104436 TTTAGTCAGAATGGAAGCCATGG - Intergenic
1034057286 7:148048527-148048549 CCTAGCCAGTAGGGAATCCATGG + Intronic
1036191503 8:6674805-6674827 CTTCGTCCGTAGTGAAACCAAGG + Intergenic
1037752064 8:21689199-21689221 CTTTGGCAGAAGTGAAGCCATGG + Intergenic
1040040727 8:42914590-42914612 CTTAGTCAGCTGAGATTCCATGG + Intronic
1040881582 8:52210745-52210767 ATTTGTCAGTAGGGAATCCATGG - Intronic
1042285281 8:67103249-67103271 CTTAGTGAGAAGTGAATTAAAGG + Intronic
1046087834 8:109460968-109460990 ATTGGTCAGAACTGATTCCATGG + Intronic
1047497123 8:125416379-125416401 CTTAGCCAGAACTGTATCCTAGG + Intergenic
1050580833 9:7054361-7054383 CGTAGTCATAAGTGAATCTCTGG + Intronic
1051398651 9:16655702-16655724 CTTTGTAATAAGTGAATTCAAGG - Intronic
1052841849 9:33298404-33298426 CTTACTCAGAACCAAATCCAAGG - Intronic
1187990586 X:24867980-24868002 ATTAGTGAAAAATGAATCCAGGG - Intronic
1190363046 X:49667001-49667023 TTTAGTCAAAAGTGACTCCAGGG - Intergenic
1190501860 X:51087089-51087111 CTTAGGCAGAATTGAATGTAAGG - Intergenic
1195708208 X:107753293-107753315 CATAGTCAGCAGTGTATTCATGG - Intronic
1197670141 X:129267850-129267872 CTTTGTCAAAAATGAATTCATGG - Intergenic
1199818702 X:151423342-151423364 CCCAGTCAGAATTGAATCCTAGG + Intergenic